Incidental Mutation 'R6180:Scn11a'
ID488008
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Namesodium channel, voltage-gated, type XI, alpha
SynonymsNaN, NSS2, NaT, SNS2
MMRRC Submission 044322-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R6180 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location119753759-119825456 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119754867 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1561 (I1561V)
Ref Sequence ENSEMBL: ENSMUSP00000149420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
Predicted Effect probably benign
Transcript: ENSMUST00000070617
AA Change: I1561V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: I1561V

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215718
AA Change: I1561V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,273,258 M1142V possibly damaging Het
Adam39 A G 8: 40,826,573 N667S probably benign Het
Ap4e1 T A 2: 127,066,588 C1085* probably null Het
BC035044 A T 6: 128,885,034 probably benign Het
Capn11 T C 17: 45,630,766 D693G probably damaging Het
Cavin4 A T 4: 48,663,917 H99L possibly damaging Het
Ccdc86 T C 19: 10,948,581 K218R possibly damaging Het
Ccno T C 13: 112,989,845 S283P probably damaging Het
Ccser2 A T 14: 36,940,319 S303T probably benign Het
Cd53 T A 3: 106,767,364 N129I probably damaging Het
Cd63 G A 10: 128,912,064 probably null Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Daam2 A G 17: 49,469,666 M797T probably damaging Het
Dmgdh G A 13: 93,752,286 V811I possibly damaging Het
Dpysl4 A T 7: 139,090,334 T123S probably damaging Het
Erap1 A G 13: 74,666,226 E428G possibly damaging Het
Fam124b T A 1: 80,200,185 T366S possibly damaging Het
Fbxw22 T C 9: 109,386,679 D167G probably damaging Het
Flrt2 C T 12: 95,779,238 Q117* probably null Het
Ftsj3 A T 11: 106,253,340 probably null Het
Ggn A G 7: 29,173,049 Y618C probably damaging Het
Glis1 T A 4: 107,627,513 S402T probably benign Het
Gm13762 T G 2: 88,973,882 N3T probably damaging Het
Gm4781 T A 10: 100,396,487 noncoding transcript Het
Gm7168 T A 17: 13,948,596 I75K probably damaging Het
Gm7298 C T 6: 121,760,823 H348Y probably benign Het
Gria1 G T 11: 57,242,792 R499L probably damaging Het
Gtf2ird2 C T 5: 134,216,547 T549M probably damaging Het
H2-M10.6 T A 17: 36,814,286 V323E probably damaging Het
Hoxb3 G A 11: 96,346,103 V336I probably benign Het
Il12b G A 11: 44,412,626 A327T probably benign Het
Inpp4a C A 1: 37,380,102 P588T probably benign Het
Kctd12 C A 14: 102,981,591 D284Y probably damaging Het
Kif28 C A 1: 179,697,772 probably null Het
Krt2 T C 15: 101,815,044 N332S probably benign Het
Lama2 G A 10: 26,981,499 T3118I probably benign Het
Lgi1 T C 19: 38,264,956 L25P probably damaging Het
Lhx3 T A 2: 26,201,491 M269L probably benign Het
Lmtk2 A T 5: 144,175,342 E960V probably damaging Het
Loxl4 A T 19: 42,608,352 D60E probably damaging Het
Lrp2 T A 2: 69,503,524 N1458Y possibly damaging Het
Ltn1 A T 16: 87,427,789 S16T probably damaging Het
Mllt6 G A 11: 97,678,536 A875T possibly damaging Het
Mpp5 C T 12: 78,817,310 H216Y probably benign Het
Mrgprb4 A T 7: 48,198,826 I118N probably damaging Het
Mrps7 A G 11: 115,604,881 T82A possibly damaging Het
Mug2 A G 6: 122,079,606 E1170G probably benign Het
Nav2 A G 7: 49,458,167 H647R probably benign Het
Nbeal2 T C 9: 110,625,147 Y2710C probably damaging Het
Ndc1 A T 4: 107,411,198 I644L possibly damaging Het
Olfr952 A T 9: 39,426,712 Y120N probably damaging Het
Padi4 A G 4: 140,756,473 M352T possibly damaging Het
Pcdhgc3 C A 18: 37,806,937 D130E probably damaging Het
Pde6a A T 18: 61,284,092 probably null Het
Pdpn C T 4: 143,299,222 G12R probably damaging Het
Pot1a A T 6: 25,771,621 D200E probably benign Het
Ppa1 A T 10: 61,667,652 D236V probably benign Het
Ptprn2 T A 12: 116,859,119 S273T probably benign Het
Rasgrf2 T C 13: 92,029,101 E297G probably damaging Het
Rgl1 T C 1: 152,519,172 N750S probably damaging Het
Rinl A G 7: 28,796,940 N449D probably benign Het
Samd8 T A 14: 21,775,025 H79Q probably benign Het
Slc39a12 T C 2: 14,396,127 L105P probably benign Het
Slc7a12 A T 3: 14,481,140 probably null Het
Slco1a4 A G 6: 141,817,820 I390T possibly damaging Het
Snta1 T C 2: 154,377,182 N411S probably benign Het
Srgap2 T C 1: 131,349,541 T323A probably benign Het
Ssh2 G T 11: 77,453,465 V759L probably benign Het
St5 A C 7: 109,556,888 D218E probably benign Het
Swap70 G T 7: 110,269,981 R327L probably damaging Het
Tbc1d4 C A 14: 101,458,770 C914F probably benign Het
Tbx3 A G 5: 119,674,067 D144G probably damaging Het
Tgfbr2 T C 9: 116,110,144 K205R possibly damaging Het
Tmem94 A T 11: 115,791,031 probably null Het
Usf3 T A 16: 44,221,105 F1983I probably damaging Het
Ush2a T A 1: 188,399,871 C763* probably null Het
Vmn1r115 A C 7: 20,844,715 L91V probably damaging Het
Vmn1r201 A T 13: 22,475,329 I238F possibly damaging Het
Vmn1r28 T A 6: 58,265,491 S106R probably damaging Het
Vmn1r82 T C 7: 12,305,085 V95A probably damaging Het
Vrk3 A T 7: 44,769,611 N371I possibly damaging Het
Wnt8b C A 19: 44,511,643 A223E probably benign Het
Xirp2 T C 2: 67,505,577 probably null Het
Xpo7 T C 14: 70,682,803 N642S probably benign Het
Ythdc1 G A 5: 86,828,094 R520H possibly damaging Het
Zfp367 T C 13: 64,135,390 E316G probably damaging Het
Zfp488 T A 14: 33,970,794 R137S possibly damaging Het
Zfp532 G T 18: 65,656,471 V994L probably benign Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119770506 missense probably benign 0.00
IGL00272:Scn11a APN 9 119816603 missense probably damaging 0.98
IGL00332:Scn11a APN 9 119769916 missense probably damaging 1.00
IGL00533:Scn11a APN 9 119774381 missense probably damaging 1.00
IGL00972:Scn11a APN 9 119793938 missense probably benign 0.44
IGL01338:Scn11a APN 9 119784161 splice site probably benign
IGL01534:Scn11a APN 9 119780822 missense probably benign 0.27
IGL01838:Scn11a APN 9 119758583 missense probably damaging 1.00
IGL01991:Scn11a APN 9 119819904 missense probably damaging 0.97
IGL02057:Scn11a APN 9 119765470 missense probably damaging 1.00
IGL02290:Scn11a APN 9 119774442 missense probably damaging 0.97
IGL02454:Scn11a APN 9 119758544 missense probably benign 0.00
IGL02517:Scn11a APN 9 119792398 missense probably damaging 1.00
IGL02567:Scn11a APN 9 119804489 missense probably damaging 0.99
IGL02587:Scn11a APN 9 119805684 missense probably damaging 1.00
IGL03069:Scn11a APN 9 119789963 missense probably benign 0.16
IGL03171:Scn11a APN 9 119819847 missense probably benign 0.00
Kleinie UTSW 9 119803503 missense probably benign 0.16
H8441:Scn11a UTSW 9 119807910 missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119769948 missense probably damaging 1.00
R0304:Scn11a UTSW 9 119819862 missense probably benign 0.00
R0519:Scn11a UTSW 9 119790119 missense probably damaging 1.00
R0658:Scn11a UTSW 9 119811160 missense probably benign 0.41
R0828:Scn11a UTSW 9 119755007 missense probably benign 0.00
R0893:Scn11a UTSW 9 119803330 splice site probably null
R0932:Scn11a UTSW 9 119807810 missense probably damaging 1.00
R1061:Scn11a UTSW 9 119795663 missense probably damaging 0.98
R1161:Scn11a UTSW 9 119755057 nonsense probably null
R1162:Scn11a UTSW 9 119805644 splice site probably benign
R1310:Scn11a UTSW 9 119755057 nonsense probably null
R1589:Scn11a UTSW 9 119769807 missense probably damaging 1.00
R1681:Scn11a UTSW 9 119804412 missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119755082 missense probably damaging 1.00
R1812:Scn11a UTSW 9 119780865 nonsense probably null
R1901:Scn11a UTSW 9 119779036 nonsense probably null
R1978:Scn11a UTSW 9 119780795 nonsense probably null
R1985:Scn11a UTSW 9 119754678 missense probably benign 0.19
R2022:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119792494 missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119755025 missense probably damaging 1.00
R2250:Scn11a UTSW 9 119758602 missense probably benign 0.01
R2373:Scn11a UTSW 9 119813186 missense probably benign 0.43
R2508:Scn11a UTSW 9 119765529 missense probably damaging 1.00
R3757:Scn11a UTSW 9 119803503 missense probably benign 0.16
R3767:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R3770:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R4089:Scn11a UTSW 9 119795653 splice site probably null
R4092:Scn11a UTSW 9 119789970 missense probably benign 0.03
R4247:Scn11a UTSW 9 119807886 missense probably damaging 1.00
R4279:Scn11a UTSW 9 119754362 missense probably benign 0.25
R4299:Scn11a UTSW 9 119765506 missense probably damaging 0.97
R4403:Scn11a UTSW 9 119795667 missense probably damaging 1.00
R4468:Scn11a UTSW 9 119754987 missense probably damaging 1.00
R4542:Scn11a UTSW 9 119755134 missense probably damaging 1.00
R4644:Scn11a UTSW 9 119815203 splice site probably null
R4739:Scn11a UTSW 9 119754561 missense probably benign 0.39
R4809:Scn11a UTSW 9 119819870 missense probably benign 0.00
R4954:Scn11a UTSW 9 119758659 missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119780878 missense probably benign 0.31
R5044:Scn11a UTSW 9 119819831 missense probably damaging 0.98
R5222:Scn11a UTSW 9 119815202 splice site probably null
R5224:Scn11a UTSW 9 119754792 missense probably damaging 1.00
R5400:Scn11a UTSW 9 119769908 missense probably damaging 0.97
R5555:Scn11a UTSW 9 119755238 missense probably damaging 1.00
R5711:Scn11a UTSW 9 119789924 missense probably damaging 1.00
R5950:Scn11a UTSW 9 119811124 missense probably damaging 1.00
R5984:Scn11a UTSW 9 119784016 missense probably benign
R6057:Scn11a UTSW 9 119765448 missense probably damaging 1.00
R6104:Scn11a UTSW 9 119795678 missense probably damaging 1.00
R6892:Scn11a UTSW 9 119806969 missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119792426 missense probably damaging 1.00
R6949:Scn11a UTSW 9 119765514 missense probably benign 0.04
R7112:Scn11a UTSW 9 119754809 missense probably damaging 1.00
R7232:Scn11a UTSW 9 119759916 missense probably damaging 1.00
R7261:Scn11a UTSW 9 119819833 missense probably damaging 0.99
R7265:Scn11a UTSW 9 119815265 missense probably damaging 1.00
R7302:Scn11a UTSW 9 119806951 missense probably benign 0.03
R7391:Scn11a UTSW 9 119795717 missense probably damaging 1.00
R7441:Scn11a UTSW 9 119758626 missense probably benign 0.01
R7479:Scn11a UTSW 9 119759875 missense probably benign 0.38
R7608:Scn11a UTSW 9 119815313 splice site probably null
R7768:Scn11a UTSW 9 119815272 missense probably benign 0.13
R7785:Scn11a UTSW 9 119816556 missense probably benign 0.00
R7794:Scn11a UTSW 9 119765514 missense probably damaging 0.99
R7818:Scn11a UTSW 9 119784111 missense probably damaging 0.97
R7884:Scn11a UTSW 9 119804551 missense probably benign 0.01
R7988:Scn11a UTSW 9 119765437 missense probably damaging 0.97
R8049:Scn11a UTSW 9 119755083 missense probably damaging 1.00
R8127:Scn11a UTSW 9 119804512 missense probably damaging 1.00
R8274:Scn11a UTSW 9 119803482 missense probably benign
R8344:Scn11a UTSW 9 119781970 missense probably benign 0.00
R8346:Scn11a UTSW 9 119778981 missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119755242 missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119754998 missense possibly damaging 0.94
Z1177:Scn11a UTSW 9 119819820 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAAACCTGTTGGGCTTGG -3'
(R):5'- GAGGCTCTGGGATTGATGAC -3'

Sequencing Primer
(F):5'- ACTGGATGAACTGTGTTGCTTC -3'
(R):5'- GCTCTGGGATTGATGACATCTTCAAC -3'
Posted On2017-10-10