Incidental Mutation 'R6180:Scn11a'
ID 488008
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Name sodium channel, voltage-gated, type XI, alpha
Synonyms NaN, NSS2, NaT, SNS2
MMRRC Submission 044322-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R6180 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 119582829-119654522 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119583933 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1561 (I1561V)
Ref Sequence ENSEMBL: ENSMUSP00000149420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
AlphaFold Q9R053
Predicted Effect probably benign
Transcript: ENSMUST00000070617
AA Change: I1561V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: I1561V

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215718
AA Change: I1561V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 A G 8: 41,279,610 (GRCm39) N667S probably benign Het
Ap4e1 T A 2: 126,908,508 (GRCm39) C1085* probably null Het
BC035044 A T 6: 128,861,997 (GRCm39) probably benign Het
Bltp2 A G 11: 78,164,084 (GRCm39) M1142V possibly damaging Het
Capn11 T C 17: 45,941,692 (GRCm39) D693G probably damaging Het
Cavin4 A T 4: 48,663,917 (GRCm39) H99L possibly damaging Het
Ccdc86 T C 19: 10,925,945 (GRCm39) K218R possibly damaging Het
Ccno T C 13: 113,126,379 (GRCm39) S283P probably damaging Het
Ccser2 A T 14: 36,662,276 (GRCm39) S303T probably benign Het
Cd53 T A 3: 106,674,680 (GRCm39) N129I probably damaging Het
Cd63 G A 10: 128,747,933 (GRCm39) probably null Het
Cyp2j6 G C 4: 96,424,323 (GRCm39) L145V probably damaging Het
Daam2 A G 17: 49,776,694 (GRCm39) M797T probably damaging Het
Dennd2b A C 7: 109,156,095 (GRCm39) D218E probably benign Het
Dmgdh G A 13: 93,888,794 (GRCm39) V811I possibly damaging Het
Dpysl4 A T 7: 138,670,250 (GRCm39) T123S probably damaging Het
Erap1 A G 13: 74,814,345 (GRCm39) E428G possibly damaging Het
Fam124b T A 1: 80,177,902 (GRCm39) T366S possibly damaging Het
Fbxw22 T C 9: 109,215,747 (GRCm39) D167G probably damaging Het
Flrt2 C T 12: 95,746,012 (GRCm39) Q117* probably null Het
Ftsj3 A T 11: 106,144,166 (GRCm39) probably null Het
Ggn A G 7: 28,872,474 (GRCm39) Y618C probably damaging Het
Glis1 T A 4: 107,484,710 (GRCm39) S402T probably benign Het
Gm4781 T A 10: 100,232,349 (GRCm39) noncoding transcript Het
Gm7168 T A 17: 14,168,858 (GRCm39) I75K probably damaging Het
Gm7298 C T 6: 121,737,782 (GRCm39) H348Y probably benign Het
Gria1 G T 11: 57,133,618 (GRCm39) R499L probably damaging Het
Gtf2ird2 C T 5: 134,245,389 (GRCm39) T549M probably damaging Het
H2-M10.6 T A 17: 37,125,178 (GRCm39) V323E probably damaging Het
Hoxb3 G A 11: 96,236,929 (GRCm39) V336I probably benign Het
Il12b G A 11: 44,303,453 (GRCm39) A327T probably benign Het
Inpp4a C A 1: 37,419,183 (GRCm39) P588T probably benign Het
Kctd12 C A 14: 103,219,027 (GRCm39) D284Y probably damaging Het
Kif28 C A 1: 179,525,337 (GRCm39) probably null Het
Krt1c T C 15: 101,723,479 (GRCm39) N332S probably benign Het
Lama2 G A 10: 26,857,495 (GRCm39) T3118I probably benign Het
Lgi1 T C 19: 38,253,404 (GRCm39) L25P probably damaging Het
Lhx3 T A 2: 26,091,503 (GRCm39) M269L probably benign Het
Lmtk2 A T 5: 144,112,160 (GRCm39) E960V probably damaging Het
Loxl4 A T 19: 42,596,791 (GRCm39) D60E probably damaging Het
Lrp2 T A 2: 69,333,868 (GRCm39) N1458Y possibly damaging Het
Ltn1 A T 16: 87,224,677 (GRCm39) S16T probably damaging Het
Mllt6 G A 11: 97,569,362 (GRCm39) A875T possibly damaging Het
Mrgprb4 A T 7: 47,848,574 (GRCm39) I118N probably damaging Het
Mrps7 A G 11: 115,495,707 (GRCm39) T82A possibly damaging Het
Mug2 A G 6: 122,056,565 (GRCm39) E1170G probably benign Het
Nav2 A G 7: 49,107,915 (GRCm39) H647R probably benign Het
Nbeal2 T C 9: 110,454,215 (GRCm39) Y2710C probably damaging Het
Ndc1 A T 4: 107,268,395 (GRCm39) I644L possibly damaging Het
Or4c108 T G 2: 88,804,226 (GRCm39) N3T probably damaging Het
Or8g33 A T 9: 39,338,008 (GRCm39) Y120N probably damaging Het
Padi4 A G 4: 140,483,784 (GRCm39) M352T possibly damaging Het
Pals1 C T 12: 78,864,084 (GRCm39) H216Y probably benign Het
Pcdhgc3 C A 18: 37,939,990 (GRCm39) D130E probably damaging Het
Pde6a A T 18: 61,417,163 (GRCm39) probably null Het
Pdpn C T 4: 143,025,792 (GRCm39) G12R probably damaging Het
Pot1a A T 6: 25,771,620 (GRCm39) D200E probably benign Het
Ppa1 A T 10: 61,503,431 (GRCm39) D236V probably benign Het
Ptprn2 T A 12: 116,822,739 (GRCm39) S273T probably benign Het
Rasgrf2 T C 13: 92,165,609 (GRCm39) E297G probably damaging Het
Rgl1 T C 1: 152,394,923 (GRCm39) N750S probably damaging Het
Rinl A G 7: 28,496,365 (GRCm39) N449D probably benign Het
Samd8 T A 14: 21,825,093 (GRCm39) H79Q probably benign Het
Slc39a12 T C 2: 14,400,938 (GRCm39) L105P probably benign Het
Slc7a12 A T 3: 14,546,200 (GRCm39) probably null Het
Slco1a4 A G 6: 141,763,546 (GRCm39) I390T possibly damaging Het
Snta1 T C 2: 154,219,102 (GRCm39) N411S probably benign Het
Srgap2 T C 1: 131,277,279 (GRCm39) T323A probably benign Het
Ssh2 G T 11: 77,344,291 (GRCm39) V759L probably benign Het
Swap70 G T 7: 109,869,188 (GRCm39) R327L probably damaging Het
Tbc1d4 C A 14: 101,696,206 (GRCm39) C914F probably benign Het
Tbx3 A G 5: 119,812,132 (GRCm39) D144G probably damaging Het
Tgfbr2 T C 9: 115,939,212 (GRCm39) K205R possibly damaging Het
Tmem94 A T 11: 115,681,857 (GRCm39) probably null Het
Usf3 T A 16: 44,041,468 (GRCm39) F1983I probably damaging Het
Ush2a T A 1: 188,132,068 (GRCm39) C763* probably null Het
Vmn1r115 A C 7: 20,578,640 (GRCm39) L91V probably damaging Het
Vmn1r201 A T 13: 22,659,499 (GRCm39) I238F possibly damaging Het
Vmn1r28 T A 6: 58,242,476 (GRCm39) S106R probably damaging Het
Vmn1r82 T C 7: 12,039,012 (GRCm39) V95A probably damaging Het
Vrk3 A T 7: 44,419,035 (GRCm39) N371I possibly damaging Het
Wnt8b C A 19: 44,500,082 (GRCm39) A223E probably benign Het
Xirp2 T C 2: 67,335,921 (GRCm39) probably null Het
Xpo7 T C 14: 70,920,243 (GRCm39) N642S probably benign Het
Ythdc1 G A 5: 86,975,953 (GRCm39) R520H possibly damaging Het
Zfp367 T C 13: 64,283,204 (GRCm39) E316G probably damaging Het
Zfp488 T A 14: 33,692,751 (GRCm39) R137S possibly damaging Het
Zfp532 G T 18: 65,789,542 (GRCm39) V994L probably benign Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119,599,572 (GRCm39) missense probably benign 0.00
IGL00272:Scn11a APN 9 119,645,669 (GRCm39) missense probably damaging 0.98
IGL00332:Scn11a APN 9 119,598,982 (GRCm39) missense probably damaging 1.00
IGL00533:Scn11a APN 9 119,603,447 (GRCm39) missense probably damaging 1.00
IGL00972:Scn11a APN 9 119,623,004 (GRCm39) missense probably benign 0.44
IGL01338:Scn11a APN 9 119,613,227 (GRCm39) splice site probably benign
IGL01534:Scn11a APN 9 119,609,888 (GRCm39) missense probably benign 0.27
IGL01838:Scn11a APN 9 119,587,649 (GRCm39) missense probably damaging 1.00
IGL01991:Scn11a APN 9 119,648,970 (GRCm39) missense probably damaging 0.97
IGL02057:Scn11a APN 9 119,594,536 (GRCm39) missense probably damaging 1.00
IGL02290:Scn11a APN 9 119,603,508 (GRCm39) missense probably damaging 0.97
IGL02454:Scn11a APN 9 119,587,610 (GRCm39) missense probably benign 0.00
IGL02517:Scn11a APN 9 119,621,464 (GRCm39) missense probably damaging 1.00
IGL02567:Scn11a APN 9 119,633,555 (GRCm39) missense probably damaging 0.99
IGL02587:Scn11a APN 9 119,634,750 (GRCm39) missense probably damaging 1.00
IGL03069:Scn11a APN 9 119,619,029 (GRCm39) missense probably benign 0.16
IGL03171:Scn11a APN 9 119,648,913 (GRCm39) missense probably benign 0.00
Kleinie UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
H8441:Scn11a UTSW 9 119,636,976 (GRCm39) missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119,599,014 (GRCm39) missense probably damaging 1.00
R0304:Scn11a UTSW 9 119,648,928 (GRCm39) missense probably benign 0.00
R0519:Scn11a UTSW 9 119,619,185 (GRCm39) missense probably damaging 1.00
R0658:Scn11a UTSW 9 119,640,226 (GRCm39) missense probably benign 0.41
R0828:Scn11a UTSW 9 119,584,073 (GRCm39) missense probably benign 0.00
R0893:Scn11a UTSW 9 119,632,396 (GRCm39) splice site probably null
R0932:Scn11a UTSW 9 119,636,876 (GRCm39) missense probably damaging 1.00
R1061:Scn11a UTSW 9 119,624,729 (GRCm39) missense probably damaging 0.98
R1161:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1162:Scn11a UTSW 9 119,634,710 (GRCm39) splice site probably benign
R1310:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1589:Scn11a UTSW 9 119,598,873 (GRCm39) missense probably damaging 1.00
R1681:Scn11a UTSW 9 119,633,478 (GRCm39) missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119,584,148 (GRCm39) missense probably damaging 1.00
R1812:Scn11a UTSW 9 119,609,931 (GRCm39) nonsense probably null
R1901:Scn11a UTSW 9 119,608,102 (GRCm39) nonsense probably null
R1978:Scn11a UTSW 9 119,609,861 (GRCm39) nonsense probably null
R1985:Scn11a UTSW 9 119,583,744 (GRCm39) missense probably benign 0.19
R2022:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119,621,560 (GRCm39) missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119,584,091 (GRCm39) missense probably damaging 1.00
R2250:Scn11a UTSW 9 119,587,668 (GRCm39) missense probably benign 0.01
R2373:Scn11a UTSW 9 119,642,252 (GRCm39) missense probably benign 0.43
R2508:Scn11a UTSW 9 119,594,595 (GRCm39) missense probably damaging 1.00
R3757:Scn11a UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
R3767:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R3770:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R4089:Scn11a UTSW 9 119,624,719 (GRCm39) splice site probably null
R4092:Scn11a UTSW 9 119,619,036 (GRCm39) missense probably benign 0.03
R4247:Scn11a UTSW 9 119,636,952 (GRCm39) missense probably damaging 1.00
R4279:Scn11a UTSW 9 119,583,428 (GRCm39) missense probably benign 0.25
R4299:Scn11a UTSW 9 119,594,572 (GRCm39) missense probably damaging 0.97
R4403:Scn11a UTSW 9 119,624,733 (GRCm39) missense probably damaging 1.00
R4468:Scn11a UTSW 9 119,584,053 (GRCm39) missense probably damaging 1.00
R4542:Scn11a UTSW 9 119,584,200 (GRCm39) missense probably damaging 1.00
R4644:Scn11a UTSW 9 119,644,269 (GRCm39) splice site probably null
R4739:Scn11a UTSW 9 119,583,627 (GRCm39) missense probably benign 0.39
R4809:Scn11a UTSW 9 119,648,936 (GRCm39) missense probably benign 0.00
R4954:Scn11a UTSW 9 119,587,725 (GRCm39) missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119,609,944 (GRCm39) missense probably benign 0.31
R5044:Scn11a UTSW 9 119,648,897 (GRCm39) missense probably damaging 0.98
R5222:Scn11a UTSW 9 119,644,268 (GRCm39) splice site probably null
R5224:Scn11a UTSW 9 119,583,858 (GRCm39) missense probably damaging 1.00
R5400:Scn11a UTSW 9 119,598,974 (GRCm39) missense probably damaging 0.97
R5555:Scn11a UTSW 9 119,584,304 (GRCm39) missense probably damaging 1.00
R5711:Scn11a UTSW 9 119,618,990 (GRCm39) missense probably damaging 1.00
R5950:Scn11a UTSW 9 119,640,190 (GRCm39) missense probably damaging 1.00
R5984:Scn11a UTSW 9 119,613,082 (GRCm39) missense probably benign
R6057:Scn11a UTSW 9 119,594,514 (GRCm39) missense probably damaging 1.00
R6104:Scn11a UTSW 9 119,624,744 (GRCm39) missense probably damaging 1.00
R6892:Scn11a UTSW 9 119,636,035 (GRCm39) missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119,621,492 (GRCm39) missense probably damaging 1.00
R6949:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably benign 0.04
R7112:Scn11a UTSW 9 119,583,875 (GRCm39) missense probably damaging 1.00
R7232:Scn11a UTSW 9 119,588,982 (GRCm39) missense probably damaging 1.00
R7261:Scn11a UTSW 9 119,648,899 (GRCm39) missense probably damaging 0.99
R7265:Scn11a UTSW 9 119,644,331 (GRCm39) missense probably damaging 1.00
R7302:Scn11a UTSW 9 119,636,017 (GRCm39) missense probably benign 0.03
R7391:Scn11a UTSW 9 119,624,783 (GRCm39) missense probably damaging 1.00
R7441:Scn11a UTSW 9 119,587,692 (GRCm39) missense probably benign 0.01
R7479:Scn11a UTSW 9 119,588,941 (GRCm39) missense probably benign 0.38
R7608:Scn11a UTSW 9 119,644,379 (GRCm39) splice site probably null
R7768:Scn11a UTSW 9 119,644,338 (GRCm39) missense probably benign 0.13
R7785:Scn11a UTSW 9 119,645,622 (GRCm39) missense probably benign 0.00
R7794:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably damaging 0.99
R7818:Scn11a UTSW 9 119,613,177 (GRCm39) missense probably damaging 0.97
R7884:Scn11a UTSW 9 119,633,617 (GRCm39) missense probably benign 0.01
R7988:Scn11a UTSW 9 119,594,503 (GRCm39) missense probably damaging 0.97
R8049:Scn11a UTSW 9 119,584,149 (GRCm39) missense probably damaging 1.00
R8127:Scn11a UTSW 9 119,633,578 (GRCm39) missense probably damaging 1.00
R8274:Scn11a UTSW 9 119,632,548 (GRCm39) missense probably benign
R8344:Scn11a UTSW 9 119,611,036 (GRCm39) missense probably benign 0.00
R8346:Scn11a UTSW 9 119,608,047 (GRCm39) missense probably damaging 1.00
R8511:Scn11a UTSW 9 119,618,981 (GRCm39) missense probably damaging 0.99
R8819:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8820:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8837:Scn11a UTSW 9 119,621,410 (GRCm39) missense probably damaging 1.00
R8913:Scn11a UTSW 9 119,623,094 (GRCm39) missense probably damaging 1.00
R8915:Scn11a UTSW 9 119,603,363 (GRCm39) nonsense probably null
R8975:Scn11a UTSW 9 119,587,565 (GRCm39) missense probably damaging 1.00
R9156:Scn11a UTSW 9 119,588,989 (GRCm39) missense possibly damaging 0.75
R9222:Scn11a UTSW 9 119,611,013 (GRCm39) missense probably damaging 0.98
R9355:Scn11a UTSW 9 119,584,160 (GRCm39) missense probably damaging 1.00
R9486:Scn11a UTSW 9 119,624,774 (GRCm39) missense possibly damaging 0.86
R9712:Scn11a UTSW 9 119,619,076 (GRCm39) nonsense probably null
R9766:Scn11a UTSW 9 119,584,181 (GRCm39) missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119,584,308 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,648,886 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,584,064 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTGAAACCTGTTGGGCTTGG -3'
(R):5'- GAGGCTCTGGGATTGATGAC -3'

Sequencing Primer
(F):5'- ACTGGATGAACTGTGTTGCTTC -3'
(R):5'- GCTCTGGGATTGATGACATCTTCAAC -3'
Posted On 2017-10-10