Mutagenetix > Incidental Mutation

Incidental Mutation 'R0524:Adamts16'

48802

Institutional Source

Beutler Lab

Gene Symbol

Adamts16

Ensembl Gene

ENSMUSG00000049538

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 16

Synonyms

MMRRC Submission

038717-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0524 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70727802-70841811 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70800894 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 216 (E216G)

Ref Sequence

ENSEMBL: ENSMUSP00000122031 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080145] [ENSMUST00000109694] [ENSMUST00000123552]

AlphaFold

Q69Z28

Predicted Effect

probably benign
Transcript: ENSMUST00000080145
AA Change: E216G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000079041
Gene: ENSMUSG00000049538
AA Change: E216G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	26	36	N/A	INTRINSIC
Pfam:Pep_M12B_propep	57	203	7.8e-34	PFAM
Pfam:Reprolysin_5	287	470	2.9e-13	PFAM
Pfam:Reprolysin_4	289	489	1.2e-8	PFAM
Pfam:Reprolysin	289	493	5.4e-32	PFAM
Pfam:Reprolysin_2	306	483	3.7e-10	PFAM
Pfam:Reprolysin_3	310	442	6.4e-11	PFAM
TSP1	587	639	1.43e-14	SMART
Pfam:ADAM_spacer1	744	856	1.3e-37	PFAM
TSP1	872	926	3.48e0	SMART
TSP1	928	985	4.84e-3	SMART
TSP1	987	1046	1.49e-3	SMART
TSP1	1052	1113	3.19e-2	SMART
TSP1	1127	1179	7.68e-6	SMART
Pfam:PLAC	1188	1218	2.9e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109694
AA Change: E216G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000105316
Gene: ENSMUSG00000049538
AA Change: E216G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	26	36	N/A	INTRINSIC
Pfam:Pep_M12B_propep	56	203	2.2e-32	PFAM
Pfam:Reprolysin_5	287	470	1.8e-13	PFAM
Pfam:Reprolysin_4	289	489	7.3e-9	PFAM
Pfam:Reprolysin	289	493	4.6e-33	PFAM
Pfam:Reprolysin_2	306	483	4.1e-10	PFAM
Pfam:Reprolysin_3	310	442	3.3e-10	PFAM
TSP1	587	639	1.43e-14	SMART
Pfam:ADAM_spacer1	744	856	1.3e-37	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000123552
AA Change: E216G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000122031
Gene: ENSMUSG00000049538
AA Change: E216G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	26	36	N/A	INTRINSIC
Pfam:Pep_M12B_propep	56	203	5.9e-33	PFAM
Pfam:Reprolysin_5	287	470	5.1e-14	PFAM
Pfam:Reprolysin_4	289	489	2.2e-9	PFAM
Pfam:Reprolysin	289	493	1.2e-33	PFAM
Pfam:Reprolysin_2	306	483	1.2e-10	PFAM
Pfam:Reprolysin_3	310	442	9.7e-11	PFAM
TSP1	587	639	1.43e-14	SMART

Coding Region Coverage

1x: 99.5%
3x: 98.7%
10x: 96.4%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is co-expressed with the Wilms tumor protein, Wt1, in the developing glomeruli of embryonic kidneys. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd3	CGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGA	1: 180,747,059		probably benign	Het
Aoc3	C	A	11: 101,337,511	P715T	probably damaging	Het
Bnipl	T	C	3: 95,249,829	D33G	probably benign	Het
Celsr2	T	C	3: 108,401,587	H1701R	probably damaging	Het
Clca3b	T	A	3: 144,825,321	H756L	probably benign	Het
Clca4a	A	G	3: 144,969,393	W159R	probably damaging	Het
Ddx49	A	T	8: 70,296,924	I252N	probably damaging	Het
Duox2	T	C	2: 122,281,836	T1290A	possibly damaging	Het
Fam111a	T	A	19: 12,588,048	I431K	probably damaging	Het
Fam135b	A	T	15: 71,462,284	D1020E	probably benign	Het
Flii	A	G	11: 60,720,061	V514A	probably damaging	Het
Frmpd1	G	A	4: 45,256,902	V157M	probably damaging	Het
Frmpd1	A	G	4: 45,283,774	D865G	probably benign	Het
Gm6970	T	A	19: 47,170,494	K214M	unknown	Het
Gsr	G	A	8: 33,669,180		probably null	Het
Hps3	A	T	3: 20,012,776	V542E	probably damaging	Het
Kcnj5	A	G	9: 32,322,974	I15T	probably benign	Het
Kif2b	T	C	11: 91,575,724	R578G	probably benign	Het
Lamb2	A	G	9: 108,484,372	R676G	possibly damaging	Het
Mrpl40	A	G	16: 18,873,552	F94S	possibly damaging	Het
Myo7b	C	T	18: 32,013,424	V103M	possibly damaging	Het
Nmt2	T	A	2: 3,305,437	W69R	probably benign	Het
Nsd3	C	A	8: 25,700,577	Q1130K	possibly damaging	Het
Olfml1	T	C	7: 107,590,177	S150P	probably damaging	Het
Olfr123	A	T	17: 37,795,605	K54*	probably null	Het
Olfr1471	A	G	19: 13,445,864	N284S	probably damaging	Het
Pask	A	T	1: 93,310,834	W1310R	probably damaging	Het
Pcdh18	T	C	3: 49,755,642	Q408R	probably damaging	Het
Pfkm	A	G	15: 98,131,607	I700V	probably benign	Het
Pias1	A	G	9: 62,952,178	V16A	probably damaging	Het
Pnpla8	C	T	12: 44,283,618	Q318*	probably null	Het
Ppp1cc	C	T	5: 122,172,770	R142*	probably null	Het
Pygl	T	A	12: 70,207,724	N149I	probably damaging	Het
Rapgef6	T	A	11: 54,690,284	S1285T	probably benign	Het
Rdh13	A	C	7: 4,444,297	C10W	probably damaging	Het
Rgr	A	T	14: 37,038,295	C273S	probably benign	Het
Ripk4	G	T	16: 97,755,287	Y22*	probably null	Het
Slc34a2	G	A	5: 53,064,873	W302*	probably null	Het
Smarce1	G	A	11: 99,214,062	T263M	probably damaging	Het
Sypl	C	T	12: 32,967,565	P94L	possibly damaging	Het
Tet3	A	G	6: 83,379,942	I878T	probably damaging	Het
Tmem232	A	G	17: 65,485,942	S87P	probably damaging	Het
Tmem260	A	G	14: 48,472,478	T163A	probably benign	Het
Ttn	T	C	2: 76,725,452	Y30403C	probably damaging	Het
Ubash3b	A	T	9: 41,016,608	M468K	probably benign	Het
Ulk4	A	G	9: 121,252,651		probably null	Het
Vmn1r72	A	G	7: 11,669,792	F243S	probably benign	Het
Wrap73	A	G	4: 154,145,307	Y45C	probably damaging	Het
Zfp704	T	C	3: 9,609,364	D119G	unknown	Het
Zfp719	A	G	7: 43,589,253		probably null	Het

Other mutations in Adamts16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Adamts16	APN	13	70795484	missense	probably benign	0.01
IGL01338:Adamts16	APN	13	70836115	missense	probably damaging	1.00
IGL01663:Adamts16	APN	13	70793141	missense	probably benign	0.01
IGL01804:Adamts16	APN	13	70800961	nonsense	probably null
IGL01874:Adamts16	APN	13	70768704	missense	possibly damaging	0.79
IGL01984:Adamts16	APN	13	70787147	missense	probably damaging	1.00
IGL02305:Adamts16	APN	13	70772929	missense	probably damaging	1.00
IGL02350:Adamts16	APN	13	70738585	missense	probably benign	0.00
IGL02357:Adamts16	APN	13	70738585	missense	probably benign	0.00
IGL02429:Adamts16	APN	13	70787170	splice site	probably benign
IGL02450:Adamts16	APN	13	70836300	missense	probably damaging	0.97
IGL02807:Adamts16	APN	13	70738778	critical splice donor site	probably null
IGL03356:Adamts16	APN	13	70753291	missense	probably benign	0.00
swap	UTSW	13	70779518	critical splice donor site	probably benign
switcheroo	UTSW	13	70800954	missense	probably benign
R0046:Adamts16	UTSW	13	70763460	missense	probably benign	0.00
R0046:Adamts16	UTSW	13	70763460	missense	probably benign	0.00
R0201:Adamts16	UTSW	13	70779644	missense	possibly damaging	0.69
R0326:Adamts16	UTSW	13	70779611	missense	possibly damaging	0.89
R0336:Adamts16	UTSW	13	70791794	critical splice donor site	probably benign
R0369:Adamts16	UTSW	13	70779552	missense	possibly damaging	0.94
R0422:Adamts16	UTSW	13	70738955	missense	probably damaging	1.00
R0507:Adamts16	UTSW	13	70768647	missense	probably benign
R0590:Adamts16	UTSW	13	70800954	missense	probably benign
R0734:Adamts16	UTSW	13	70738481	splice site	probably benign
R0787:Adamts16	UTSW	13	70738829	missense	probably damaging	1.00
R0826:Adamts16	UTSW	13	70768692	missense	possibly damaging	0.64
R0920:Adamts16	UTSW	13	70763561	splice site	probably benign
R1027:Adamts16	UTSW	13	70767802	missense	probably damaging	1.00
R1462:Adamts16	UTSW	13	70836134	missense	probably benign	0.00
R1462:Adamts16	UTSW	13	70836134	missense	probably benign	0.00
R1535:Adamts16	UTSW	13	70791794	critical splice donor site	probably null
R1617:Adamts16	UTSW	13	70798035	missense	probably benign	0.09
R1700:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R1734:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R1736:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R1737:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R1738:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R1746:Adamts16	UTSW	13	70779598	splice site	probably null
R1869:Adamts16	UTSW	13	70735747	missense	probably damaging	1.00
R1944:Adamts16	UTSW	13	70791886	missense	possibly damaging	0.93
R1997:Adamts16	UTSW	13	70753267	missense	probably benign	0.39
R2018:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R2135:Adamts16	UTSW	13	70801007	missense	probably damaging	1.00
R2219:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R2228:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R3410:Adamts16	UTSW	13	70753226	missense	probably benign	0.00
R3411:Adamts16	UTSW	13	70753226	missense	probably benign	0.00
R3842:Adamts16	UTSW	13	70738891	missense	possibly damaging	0.92
R4117:Adamts16	UTSW	13	70767992	missense	probably benign	0.01
R4435:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4436:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4526:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4552:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4555:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4556:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4557:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4579:Adamts16	UTSW	13	70779624	missense	probably damaging	1.00
R4639:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4640:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4641:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4642:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4672:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R5350:Adamts16	UTSW	13	70753196	nonsense	probably null
R5464:Adamts16	UTSW	13	70761749	missense	probably benign	0.01
R5613:Adamts16	UTSW	13	70730134	missense	probably benign	0.01
R5667:Adamts16	UTSW	13	70836375	nonsense	probably null
R5735:Adamts16	UTSW	13	70836218	missense	possibly damaging	0.94
R5762:Adamts16	UTSW	13	70738498	missense	probably damaging	1.00
R5907:Adamts16	UTSW	13	70728910	missense	probably damaging	1.00
R6169:Adamts16	UTSW	13	70770274	nonsense	probably null
R6351:Adamts16	UTSW	13	70836203	missense	probably damaging	1.00
R6665:Adamts16	UTSW	13	70779570	missense	probably damaging	1.00
R6913:Adamts16	UTSW	13	70728898	missense	possibly damaging	0.94
R6982:Adamts16	UTSW	13	70768520	splice site	probably null
R6996:Adamts16	UTSW	13	70798038	critical splice acceptor site	probably null
R7313:Adamts16	UTSW	13	70772955	nonsense	probably null
R7356:Adamts16	UTSW	13	70836280	missense	probably benign	0.03
R7509:Adamts16	UTSW	13	70787164	missense	probably damaging	1.00
R7595:Adamts16	UTSW	13	70730115	missense	probably damaging	1.00
R7782:Adamts16	UTSW	13	70836146	missense	probably damaging	0.97
R7968:Adamts16	UTSW	13	70738582	missense	probably benign
R8231:Adamts16	UTSW	13	70777480	missense	probably damaging	0.99
R8232:Adamts16	UTSW	13	70793098	missense	probably damaging	1.00
R8470:Adamts16	UTSW	13	70836377	missense	probably damaging	1.00
R8485:Adamts16	UTSW	13	70738675	missense	possibly damaging	0.89
R8772:Adamts16	UTSW	13	70836334	missense	probably damaging	1.00
R8916:Adamts16	UTSW	13	70793188	missense	probably damaging	1.00
R8921:Adamts16	UTSW	13	70791791	splice site	probably benign
R8973:Adamts16	UTSW	13	70738840	missense	probably benign	0.00
R9132:Adamts16	UTSW	13	70753289	missense	probably benign	0.39
R9149:Adamts16	UTSW	13	70735829	missense	probably damaging	1.00
R9159:Adamts16	UTSW	13	70753289	missense	probably benign	0.39
R9312:Adamts16	UTSW	13	70800926	missense	probably damaging	1.00
R9584:Adamts16	UTSW	13	70801017	missense	probably damaging	1.00
Z1176:Adamts16	UTSW	13	70761773	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACCTCAGCAGGAAAAGTATGTGAGC -3'
(R):5'- AATCTAGGGTGGAGAACCAGTGCC -3'

Sequencing Primer
(F):5'- TTAATCTGTGCAAGGACAAGC -3'
(R):5'- GGAGAACCAGTGCCATTGC -3'

Posted On

2013-06-12