Incidental Mutation 'R6180:Flrt2'
ID488022
Institutional Source Beutler Lab
Gene Symbol Flrt2
Ensembl Gene ENSMUSG00000047414
Gene Namefibronectin leucine rich transmembrane protein 2
Synonyms
MMRRC Submission 044322-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6180 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location95692226-95785215 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 95779238 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 117 (Q117*)
Ref Sequence ENSEMBL: ENSMUSP00000105744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057324] [ENSMUST00000110117]
PDB Structure
mouse FLRT2 LRR domain in complex with rat Unc5D Ig1 domain [X-RAY DIFFRACTION]
FLRT2 LRR domain [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000057324
AA Change: Q117*
SMART Domains Protein: ENSMUSP00000062171
Gene: ENSMUSG00000047414
AA Change: Q117*

DomainStartEndE-ValueType
LRRNT 35 67 1.51e-4 SMART
LRR 107 131 1.29e1 SMART
LRR 132 157 4.32e0 SMART
LRR 159 181 6.78e1 SMART
LRR 182 202 6.97e1 SMART
LRR 203 228 7.16e0 SMART
LRR 252 274 5.26e0 SMART
LRR_TYP 275 298 2.43e-4 SMART
LRRCT 310 361 1.17e-7 SMART
low complexity region 368 400 N/A INTRINSIC
FN3 420 502 5.07e0 SMART
transmembrane domain 542 564 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110117
AA Change: Q117*
SMART Domains Protein: ENSMUSP00000105744
Gene: ENSMUSG00000047414
AA Change: Q117*

DomainStartEndE-ValueType
LRRNT 35 67 1.51e-4 SMART
LRR 107 131 1.29e1 SMART
LRR 132 157 4.32e0 SMART
LRR 159 181 6.78e1 SMART
LRR 182 202 6.97e1 SMART
LRR 203 228 7.16e0 SMART
LRR 252 274 5.26e0 SMART
LRR_TYP 275 298 2.43e-4 SMART
LRRCT 310 361 1.17e-7 SMART
low complexity region 368 400 N/A INTRINSIC
FN3 420 502 5.07e0 SMART
transmembrane domain 542 564 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fibronectin leucine rich transmembrane (FLRT) family of cell adhesion molecules, which regulate early embryonic vascular and neural development. The encoded type I transmembrane protein has an extracellular region consisting of an N-terminal leucine-rich repeat domain and a type 3 fibronectin domain, followed by a transmembrane domain and a short C-terminal cytoplasmic tail domain. It functions as both a homophilic cell adhesion molecule and a heterophilic chemorepellent through its interaction with members of the uncoordinated-5 receptor family. Proteolytic removal of the extracellular region controls the migration of neurons in the developing cortex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic, fetal, and postnatel lethality with few mice surviving to weaning due to defects in epicardium, myocardium, and endocardium development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,273,258 M1142V possibly damaging Het
Adam39 A G 8: 40,826,573 N667S probably benign Het
Ap4e1 T A 2: 127,066,588 C1085* probably null Het
BC035044 A T 6: 128,885,034 probably benign Het
Capn11 T C 17: 45,630,766 D693G probably damaging Het
Cavin4 A T 4: 48,663,917 H99L possibly damaging Het
Ccdc86 T C 19: 10,948,581 K218R possibly damaging Het
Ccno T C 13: 112,989,845 S283P probably damaging Het
Ccser2 A T 14: 36,940,319 S303T probably benign Het
Cd53 T A 3: 106,767,364 N129I probably damaging Het
Cd63 G A 10: 128,912,064 probably null Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Daam2 A G 17: 49,469,666 M797T probably damaging Het
Dmgdh G A 13: 93,752,286 V811I possibly damaging Het
Dpysl4 A T 7: 139,090,334 T123S probably damaging Het
Erap1 A G 13: 74,666,226 E428G possibly damaging Het
Fam124b T A 1: 80,200,185 T366S possibly damaging Het
Fbxw22 T C 9: 109,386,679 D167G probably damaging Het
Ftsj3 A T 11: 106,253,340 probably null Het
Ggn A G 7: 29,173,049 Y618C probably damaging Het
Glis1 T A 4: 107,627,513 S402T probably benign Het
Gm13762 T G 2: 88,973,882 N3T probably damaging Het
Gm4781 T A 10: 100,396,487 noncoding transcript Het
Gm7168 T A 17: 13,948,596 I75K probably damaging Het
Gm7298 C T 6: 121,760,823 H348Y probably benign Het
Gria1 G T 11: 57,242,792 R499L probably damaging Het
Gtf2ird2 C T 5: 134,216,547 T549M probably damaging Het
H2-M10.6 T A 17: 36,814,286 V323E probably damaging Het
Hoxb3 G A 11: 96,346,103 V336I probably benign Het
Il12b G A 11: 44,412,626 A327T probably benign Het
Inpp4a C A 1: 37,380,102 P588T probably benign Het
Kctd12 C A 14: 102,981,591 D284Y probably damaging Het
Kif28 C A 1: 179,697,772 probably null Het
Krt2 T C 15: 101,815,044 N332S probably benign Het
Lama2 G A 10: 26,981,499 T3118I probably benign Het
Lgi1 T C 19: 38,264,956 L25P probably damaging Het
Lhx3 T A 2: 26,201,491 M269L probably benign Het
Lmtk2 A T 5: 144,175,342 E960V probably damaging Het
Loxl4 A T 19: 42,608,352 D60E probably damaging Het
Lrp2 T A 2: 69,503,524 N1458Y possibly damaging Het
Ltn1 A T 16: 87,427,789 S16T probably damaging Het
Mllt6 G A 11: 97,678,536 A875T possibly damaging Het
Mpp5 C T 12: 78,817,310 H216Y probably benign Het
Mrgprb4 A T 7: 48,198,826 I118N probably damaging Het
Mrps7 A G 11: 115,604,881 T82A possibly damaging Het
Mug2 A G 6: 122,079,606 E1170G probably benign Het
Nav2 A G 7: 49,458,167 H647R probably benign Het
Nbeal2 T C 9: 110,625,147 Y2710C probably damaging Het
Ndc1 A T 4: 107,411,198 I644L possibly damaging Het
Olfr952 A T 9: 39,426,712 Y120N probably damaging Het
Padi4 A G 4: 140,756,473 M352T possibly damaging Het
Pcdhgc3 C A 18: 37,806,937 D130E probably damaging Het
Pde6a A T 18: 61,284,092 probably null Het
Pdpn C T 4: 143,299,222 G12R probably damaging Het
Pot1a A T 6: 25,771,621 D200E probably benign Het
Ppa1 A T 10: 61,667,652 D236V probably benign Het
Ptprn2 T A 12: 116,859,119 S273T probably benign Het
Rasgrf2 T C 13: 92,029,101 E297G probably damaging Het
Rgl1 T C 1: 152,519,172 N750S probably damaging Het
Rinl A G 7: 28,796,940 N449D probably benign Het
Samd8 T A 14: 21,775,025 H79Q probably benign Het
Scn11a T C 9: 119,754,867 I1561V probably benign Het
Slc39a12 T C 2: 14,396,127 L105P probably benign Het
Slc7a12 A T 3: 14,481,140 probably null Het
Slco1a4 A G 6: 141,817,820 I390T possibly damaging Het
Snta1 T C 2: 154,377,182 N411S probably benign Het
Srgap2 T C 1: 131,349,541 T323A probably benign Het
Ssh2 G T 11: 77,453,465 V759L probably benign Het
St5 A C 7: 109,556,888 D218E probably benign Het
Swap70 G T 7: 110,269,981 R327L probably damaging Het
Tbc1d4 C A 14: 101,458,770 C914F probably benign Het
Tbx3 A G 5: 119,674,067 D144G probably damaging Het
Tgfbr2 T C 9: 116,110,144 K205R possibly damaging Het
Tmem94 A T 11: 115,791,031 probably null Het
Usf3 T A 16: 44,221,105 F1983I probably damaging Het
Ush2a T A 1: 188,399,871 C763* probably null Het
Vmn1r115 A C 7: 20,844,715 L91V probably damaging Het
Vmn1r201 A T 13: 22,475,329 I238F possibly damaging Het
Vmn1r28 T A 6: 58,265,491 S106R probably damaging Het
Vmn1r82 T C 7: 12,305,085 V95A probably damaging Het
Vrk3 A T 7: 44,769,611 N371I possibly damaging Het
Wnt8b C A 19: 44,511,643 A223E probably benign Het
Xirp2 T C 2: 67,505,577 probably null Het
Xpo7 T C 14: 70,682,803 N642S probably benign Het
Ythdc1 G A 5: 86,828,094 R520H possibly damaging Het
Zfp367 T C 13: 64,135,390 E316G probably damaging Het
Zfp488 T A 14: 33,970,794 R137S possibly damaging Het
Zfp532 G T 18: 65,656,471 V994L probably benign Het
Other mutations in Flrt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Flrt2 APN 12 95780529 missense probably damaging 1.00
IGL01083:Flrt2 APN 12 95780347 missense probably benign 0.05
IGL01410:Flrt2 APN 12 95779192 missense probably damaging 1.00
IGL01601:Flrt2 APN 12 95779595 missense probably damaging 0.99
IGL01800:Flrt2 APN 12 95779688 missense probably damaging 1.00
IGL01940:Flrt2 APN 12 95780238 missense probably damaging 1.00
IGL02224:Flrt2 APN 12 95780028 missense possibly damaging 0.58
IGL02272:Flrt2 APN 12 95779704 missense probably damaging 1.00
IGL02452:Flrt2 APN 12 95779483 missense probably benign 0.01
R0966:Flrt2 UTSW 12 95780301 missense possibly damaging 0.70
R1066:Flrt2 UTSW 12 95779059 missense probably damaging 1.00
R1218:Flrt2 UTSW 12 95778953 missense probably benign 0.00
R1442:Flrt2 UTSW 12 95780205 missense probably damaging 1.00
R1462:Flrt2 UTSW 12 95779338 missense probably damaging 1.00
R1462:Flrt2 UTSW 12 95779338 missense probably damaging 1.00
R1746:Flrt2 UTSW 12 95780792 missense possibly damaging 0.90
R1842:Flrt2 UTSW 12 95779284 missense probably damaging 1.00
R1901:Flrt2 UTSW 12 95779130 missense probably damaging 1.00
R1901:Flrt2 UTSW 12 95779131 missense probably damaging 1.00
R1959:Flrt2 UTSW 12 95780300 missense probably benign 0.01
R2310:Flrt2 UTSW 12 95780090 missense probably benign 0.01
R3418:Flrt2 UTSW 12 95780604 missense probably damaging 1.00
R3419:Flrt2 UTSW 12 95780604 missense probably damaging 1.00
R4412:Flrt2 UTSW 12 95780273 missense probably benign
R4617:Flrt2 UTSW 12 95780229 missense possibly damaging 0.96
R4674:Flrt2 UTSW 12 95780688 nonsense probably null
R5001:Flrt2 UTSW 12 95778951 missense probably benign
R5009:Flrt2 UTSW 12 95779773 missense probably damaging 0.98
R5150:Flrt2 UTSW 12 95779203 missense possibly damaging 0.84
R5179:Flrt2 UTSW 12 95780347 missense probably benign 0.05
R5269:Flrt2 UTSW 12 95779938 missense possibly damaging 0.46
R5535:Flrt2 UTSW 12 95780426 missense probably benign 0.08
R6172:Flrt2 UTSW 12 95779531 missense probably damaging 1.00
R6867:Flrt2 UTSW 12 95779382 missense probably damaging 1.00
R6986:Flrt2 UTSW 12 95780685 missense probably damaging 1.00
R7379:Flrt2 UTSW 12 95780555 missense possibly damaging 0.68
R7407:Flrt2 UTSW 12 95779300 missense probably damaging 1.00
R7711:Flrt2 UTSW 12 95780754 missense probably damaging 1.00
R8065:Flrt2 UTSW 12 95780774 missense probably benign 0.00
Z1176:Flrt2 UTSW 12 95778912 missense possibly damaging 0.76
Z1176:Flrt2 UTSW 12 95779559 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGAGAGAAGCTTGACCTCAG -3'
(R):5'- TGCAAGTCTACAGGAAGCCC -3'

Sequencing Primer
(F):5'- AGAAGCTTGACCTCAGTGCCTC -3'
(R):5'- GTCTACAGGAAGCCCAACAGG -3'
Posted On2017-10-10