Incidental Mutation 'R6180:Ptprn2'
ID 488023
Institutional Source Beutler Lab
Gene Symbol Ptprn2
Ensembl Gene ENSMUSG00000056553
Gene Name protein tyrosine phosphatase receptor type N polypeptide 2
Synonyms IA-2 beta, PTP-NP, 4930425H11Rik, IA-2beta, phogrin
MMRRC Submission 044322-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.162) question?
Stock # R6180 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 116449340-117240469 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 116822739 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 273 (S273T)
Ref Sequence ENSEMBL: ENSMUSP00000139978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]
AlphaFold P80560
Predicted Effect probably benign
Transcript: ENSMUST00000070733
AA Change: S273T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: S273T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 495 583 1.5e-35 PFAM
low complexity region 687 707 N/A INTRINSIC
PTPc 730 993 4.42e-119 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189009
Predicted Effect probably benign
Transcript: ENSMUST00000190247
AA Change: S273T

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: S273T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 494 584 2.5e-43 PFAM
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 687 707 N/A INTRINSIC
PTPc 730 932 8.81e-64 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 A G 8: 41,279,610 (GRCm39) N667S probably benign Het
Ap4e1 T A 2: 126,908,508 (GRCm39) C1085* probably null Het
BC035044 A T 6: 128,861,997 (GRCm39) probably benign Het
Bltp2 A G 11: 78,164,084 (GRCm39) M1142V possibly damaging Het
Capn11 T C 17: 45,941,692 (GRCm39) D693G probably damaging Het
Cavin4 A T 4: 48,663,917 (GRCm39) H99L possibly damaging Het
Ccdc86 T C 19: 10,925,945 (GRCm39) K218R possibly damaging Het
Ccno T C 13: 113,126,379 (GRCm39) S283P probably damaging Het
Ccser2 A T 14: 36,662,276 (GRCm39) S303T probably benign Het
Cd53 T A 3: 106,674,680 (GRCm39) N129I probably damaging Het
Cd63 G A 10: 128,747,933 (GRCm39) probably null Het
Cyp2j6 G C 4: 96,424,323 (GRCm39) L145V probably damaging Het
Daam2 A G 17: 49,776,694 (GRCm39) M797T probably damaging Het
Dennd2b A C 7: 109,156,095 (GRCm39) D218E probably benign Het
Dmgdh G A 13: 93,888,794 (GRCm39) V811I possibly damaging Het
Dpysl4 A T 7: 138,670,250 (GRCm39) T123S probably damaging Het
Erap1 A G 13: 74,814,345 (GRCm39) E428G possibly damaging Het
Fam124b T A 1: 80,177,902 (GRCm39) T366S possibly damaging Het
Fbxw22 T C 9: 109,215,747 (GRCm39) D167G probably damaging Het
Flrt2 C T 12: 95,746,012 (GRCm39) Q117* probably null Het
Ftsj3 A T 11: 106,144,166 (GRCm39) probably null Het
Ggn A G 7: 28,872,474 (GRCm39) Y618C probably damaging Het
Glis1 T A 4: 107,484,710 (GRCm39) S402T probably benign Het
Gm4781 T A 10: 100,232,349 (GRCm39) noncoding transcript Het
Gm7168 T A 17: 14,168,858 (GRCm39) I75K probably damaging Het
Gm7298 C T 6: 121,737,782 (GRCm39) H348Y probably benign Het
Gria1 G T 11: 57,133,618 (GRCm39) R499L probably damaging Het
Gtf2ird2 C T 5: 134,245,389 (GRCm39) T549M probably damaging Het
H2-M10.6 T A 17: 37,125,178 (GRCm39) V323E probably damaging Het
Hoxb3 G A 11: 96,236,929 (GRCm39) V336I probably benign Het
Il12b G A 11: 44,303,453 (GRCm39) A327T probably benign Het
Inpp4a C A 1: 37,419,183 (GRCm39) P588T probably benign Het
Kctd12 C A 14: 103,219,027 (GRCm39) D284Y probably damaging Het
Kif28 C A 1: 179,525,337 (GRCm39) probably null Het
Krt1c T C 15: 101,723,479 (GRCm39) N332S probably benign Het
Lama2 G A 10: 26,857,495 (GRCm39) T3118I probably benign Het
Lgi1 T C 19: 38,253,404 (GRCm39) L25P probably damaging Het
Lhx3 T A 2: 26,091,503 (GRCm39) M269L probably benign Het
Lmtk2 A T 5: 144,112,160 (GRCm39) E960V probably damaging Het
Loxl4 A T 19: 42,596,791 (GRCm39) D60E probably damaging Het
Lrp2 T A 2: 69,333,868 (GRCm39) N1458Y possibly damaging Het
Ltn1 A T 16: 87,224,677 (GRCm39) S16T probably damaging Het
Mllt6 G A 11: 97,569,362 (GRCm39) A875T possibly damaging Het
Mrgprb4 A T 7: 47,848,574 (GRCm39) I118N probably damaging Het
Mrps7 A G 11: 115,495,707 (GRCm39) T82A possibly damaging Het
Mug2 A G 6: 122,056,565 (GRCm39) E1170G probably benign Het
Nav2 A G 7: 49,107,915 (GRCm39) H647R probably benign Het
Nbeal2 T C 9: 110,454,215 (GRCm39) Y2710C probably damaging Het
Ndc1 A T 4: 107,268,395 (GRCm39) I644L possibly damaging Het
Or4c108 T G 2: 88,804,226 (GRCm39) N3T probably damaging Het
Or8g33 A T 9: 39,338,008 (GRCm39) Y120N probably damaging Het
Padi4 A G 4: 140,483,784 (GRCm39) M352T possibly damaging Het
Pals1 C T 12: 78,864,084 (GRCm39) H216Y probably benign Het
Pcdhgc3 C A 18: 37,939,990 (GRCm39) D130E probably damaging Het
Pde6a A T 18: 61,417,163 (GRCm39) probably null Het
Pdpn C T 4: 143,025,792 (GRCm39) G12R probably damaging Het
Pot1a A T 6: 25,771,620 (GRCm39) D200E probably benign Het
Ppa1 A T 10: 61,503,431 (GRCm39) D236V probably benign Het
Rasgrf2 T C 13: 92,165,609 (GRCm39) E297G probably damaging Het
Rgl1 T C 1: 152,394,923 (GRCm39) N750S probably damaging Het
Rinl A G 7: 28,496,365 (GRCm39) N449D probably benign Het
Samd8 T A 14: 21,825,093 (GRCm39) H79Q probably benign Het
Scn11a T C 9: 119,583,933 (GRCm39) I1561V probably benign Het
Slc39a12 T C 2: 14,400,938 (GRCm39) L105P probably benign Het
Slc7a12 A T 3: 14,546,200 (GRCm39) probably null Het
Slco1a4 A G 6: 141,763,546 (GRCm39) I390T possibly damaging Het
Snta1 T C 2: 154,219,102 (GRCm39) N411S probably benign Het
Srgap2 T C 1: 131,277,279 (GRCm39) T323A probably benign Het
Ssh2 G T 11: 77,344,291 (GRCm39) V759L probably benign Het
Swap70 G T 7: 109,869,188 (GRCm39) R327L probably damaging Het
Tbc1d4 C A 14: 101,696,206 (GRCm39) C914F probably benign Het
Tbx3 A G 5: 119,812,132 (GRCm39) D144G probably damaging Het
Tgfbr2 T C 9: 115,939,212 (GRCm39) K205R possibly damaging Het
Tmem94 A T 11: 115,681,857 (GRCm39) probably null Het
Usf3 T A 16: 44,041,468 (GRCm39) F1983I probably damaging Het
Ush2a T A 1: 188,132,068 (GRCm39) C763* probably null Het
Vmn1r115 A C 7: 20,578,640 (GRCm39) L91V probably damaging Het
Vmn1r201 A T 13: 22,659,499 (GRCm39) I238F possibly damaging Het
Vmn1r28 T A 6: 58,242,476 (GRCm39) S106R probably damaging Het
Vmn1r82 T C 7: 12,039,012 (GRCm39) V95A probably damaging Het
Vrk3 A T 7: 44,419,035 (GRCm39) N371I possibly damaging Het
Wnt8b C A 19: 44,500,082 (GRCm39) A223E probably benign Het
Xirp2 T C 2: 67,335,921 (GRCm39) probably null Het
Xpo7 T C 14: 70,920,243 (GRCm39) N642S probably benign Het
Ythdc1 G A 5: 86,975,953 (GRCm39) R520H possibly damaging Het
Zfp367 T C 13: 64,283,204 (GRCm39) E316G probably damaging Het
Zfp488 T A 14: 33,692,751 (GRCm39) R137S possibly damaging Het
Zfp532 G T 18: 65,789,542 (GRCm39) V994L probably benign Het
Other mutations in Ptprn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Ptprn2 APN 12 116,805,008 (GRCm39) missense probably benign 0.02
IGL01788:Ptprn2 APN 12 116,864,607 (GRCm39) missense probably damaging 0.98
IGL02172:Ptprn2 APN 12 116,837,317 (GRCm39) splice site probably benign
IGL02339:Ptprn2 APN 12 116,685,724 (GRCm39) missense probably damaging 1.00
IGL02706:Ptprn2 APN 12 116,852,518 (GRCm39) missense probably damaging 0.96
IGL03018:Ptprn2 APN 12 117,175,563 (GRCm39) missense probably damaging 1.00
IGL03267:Ptprn2 APN 12 116,839,964 (GRCm39) nonsense probably null
BB001:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
BB011:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
IGL03014:Ptprn2 UTSW 12 117,212,308 (GRCm39) missense probably damaging 1.00
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0115:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0132:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0481:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0694:Ptprn2 UTSW 12 116,787,975 (GRCm39) missense possibly damaging 0.69
R0698:Ptprn2 UTSW 12 116,685,750 (GRCm39) nonsense probably null
R0746:Ptprn2 UTSW 12 116,864,637 (GRCm39) missense probably benign 0.00
R1127:Ptprn2 UTSW 12 117,175,628 (GRCm39) splice site probably null
R1443:Ptprn2 UTSW 12 117,217,235 (GRCm39) missense probably damaging 1.00
R1508:Ptprn2 UTSW 12 117,148,342 (GRCm39) missense probably damaging 1.00
R1664:Ptprn2 UTSW 12 117,125,329 (GRCm39) missense probably damaging 0.99
R1670:Ptprn2 UTSW 12 116,685,792 (GRCm39) missense possibly damaging 0.64
R1749:Ptprn2 UTSW 12 116,544,048 (GRCm39) missense probably benign 0.00
R2075:Ptprn2 UTSW 12 117,211,337 (GRCm39) missense probably benign 0.01
R3054:Ptprn2 UTSW 12 116,685,753 (GRCm39) missense probably damaging 1.00
R3107:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3109:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3552:Ptprn2 UTSW 12 116,852,497 (GRCm39) missense probably benign 0.00
R4193:Ptprn2 UTSW 12 116,864,628 (GRCm39) missense probably benign 0.01
R4523:Ptprn2 UTSW 12 116,839,620 (GRCm39) missense probably damaging 1.00
R4706:Ptprn2 UTSW 12 116,835,714 (GRCm39) missense probably benign 0.02
R4719:Ptprn2 UTSW 12 116,788,016 (GRCm39) missense possibly damaging 0.95
R4726:Ptprn2 UTSW 12 117,211,393 (GRCm39) nonsense probably null
R4872:Ptprn2 UTSW 12 117,125,314 (GRCm39) missense probably damaging 1.00
R4891:Ptprn2 UTSW 12 117,196,985 (GRCm39) splice site probably null
R4970:Ptprn2 UTSW 12 117,240,215 (GRCm39) missense probably damaging 1.00
R5208:Ptprn2 UTSW 12 116,822,548 (GRCm39) missense probably damaging 1.00
R5287:Ptprn2 UTSW 12 117,175,482 (GRCm39) missense probably damaging 1.00
R5419:Ptprn2 UTSW 12 117,148,267 (GRCm39) missense probably damaging 0.99
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6277:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R6465:Ptprn2 UTSW 12 117,233,209 (GRCm39) missense probably damaging 0.96
R6488:Ptprn2 UTSW 12 116,835,658 (GRCm39) missense probably benign 0.13
R6555:Ptprn2 UTSW 12 117,190,820 (GRCm39) missense probably damaging 1.00
R6908:Ptprn2 UTSW 12 116,852,508 (GRCm39) missense probably benign 0.06
R7120:Ptprn2 UTSW 12 116,835,676 (GRCm39) missense probably benign 0.01
R7229:Ptprn2 UTSW 12 117,190,845 (GRCm39) splice site probably null
R7237:Ptprn2 UTSW 12 117,125,347 (GRCm39) missense probably benign 0.03
R7304:Ptprn2 UTSW 12 117,212,164 (GRCm39) missense probably damaging 1.00
R7355:Ptprn2 UTSW 12 116,822,571 (GRCm39) missense probably benign
R7460:Ptprn2 UTSW 12 117,212,301 (GRCm39) missense probably benign 0.05
R7577:Ptprn2 UTSW 12 116,449,486 (GRCm39) start codon destroyed probably null
R7658:Ptprn2 UTSW 12 116,685,739 (GRCm39) missense probably benign 0.01
R7666:Ptprn2 UTSW 12 116,804,940 (GRCm39) missense probably benign 0.10
R7924:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
R8219:Ptprn2 UTSW 12 117,148,357 (GRCm39) missense probably benign 0.30
R8716:Ptprn2 UTSW 12 117,219,168 (GRCm39) missense possibly damaging 0.73
R9235:Ptprn2 UTSW 12 117,233,271 (GRCm39) critical splice donor site probably null
R9605:Ptprn2 UTSW 12 117,125,278 (GRCm39) missense probably benign 0.13
X0066:Ptprn2 UTSW 12 117,148,360 (GRCm39) missense probably benign 0.16
X0066:Ptprn2 UTSW 12 117,125,380 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCCTGATAACCTTCTGCGGC -3'
(R):5'- TTCCTCTCTGCAATGGGGAAC -3'

Sequencing Primer
(F):5'- GATAACCTTCTGCGGCCCTTTAG -3'
(R):5'- TCTCTGCAATGGGGAACTCTGAAC -3'
Posted On 2017-10-10