Mutagenetix > Incidental Mutation

Incidental Mutation 'R6180:Rasgrf2'

488027

Institutional Source

Beutler Lab

Gene Symbol

Rasgrf2

Ensembl Gene

ENSMUSG00000021708

Gene Name

RAS protein-specific guanine nucleotide-releasing factor 2

Synonyms

Grf2, 6330417G04Rik

MMRRC Submission

044322-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.165) question?

Stock #

R6180 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

91880400-92131656 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 92029101 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 297 (E297G)

Ref Sequence

ENSEMBL: ENSMUSP00000116203 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099326] [ENSMUST00000146492] [ENSMUST00000216219]

AlphaFold

P70392

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099326
AA Change: E297G

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: E297G

Domain	Start	End	E-Value	Type
PH	23	135	1.29e-16	SMART
IQ	204	226	1.3e0	SMART
RhoGEF	247	428	2.2e-51	SMART
RasGEFN	633	775	9.35e-15	SMART
RasGEFN	786	923	6.04e-9	SMART
RasGEF	949	1186	2.97e-112	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000146492
AA Change: E297G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116203
Gene: ENSMUSG00000021708
AA Change: E297G

Domain	Start	End	E-Value	Type
PH	23	135	1.29e-16	SMART
IQ	204	226	1.3e0	SMART
Pfam:RhoGEF	247	387	1.2e-24	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000149630
AA Change: E77G

SMART Domains

Protein: ENSMUSP00000115562
Gene: ENSMUSG00000021708
AA Change: E77G

Domain	Start	End	E-Value	Type
Pfam:RhoGEF	28	168	4.3e-26	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000216219
AA Change: E297G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	A	G	11: 78,273,258	M1142V	possibly damaging	Het
Adam39	A	G	8: 40,826,573	N667S	probably benign	Het
Ap4e1	T	A	2: 127,066,588	C1085*	probably null	Het
BC035044	A	T	6: 128,885,034		probably benign	Het
Capn11	T	C	17: 45,630,766	D693G	probably damaging	Het
Cavin4	A	T	4: 48,663,917	H99L	possibly damaging	Het
Ccdc86	T	C	19: 10,948,581	K218R	possibly damaging	Het
Ccno	T	C	13: 112,989,845	S283P	probably damaging	Het
Ccser2	A	T	14: 36,940,319	S303T	probably benign	Het
Cd53	T	A	3: 106,767,364	N129I	probably damaging	Het
Cd63	G	A	10: 128,912,064		probably null	Het
Cyp2j6	G	C	4: 96,536,086	L145V	probably damaging	Het
Daam2	A	G	17: 49,469,666	M797T	probably damaging	Het
Dmgdh	G	A	13: 93,752,286	V811I	possibly damaging	Het
Dpysl4	A	T	7: 139,090,334	T123S	probably damaging	Het
Erap1	A	G	13: 74,666,226	E428G	possibly damaging	Het
Fam124b	T	A	1: 80,200,185	T366S	possibly damaging	Het
Fbxw22	T	C	9: 109,386,679	D167G	probably damaging	Het
Flrt2	C	T	12: 95,779,238	Q117*	probably null	Het
Ftsj3	A	T	11: 106,253,340		probably null	Het
Ggn	A	G	7: 29,173,049	Y618C	probably damaging	Het
Glis1	T	A	4: 107,627,513	S402T	probably benign	Het
Gm13762	T	G	2: 88,973,882	N3T	probably damaging	Het
Gm4781	T	A	10: 100,396,487		noncoding transcript	Het
Gm7168	T	A	17: 13,948,596	I75K	probably damaging	Het
Gm7298	C	T	6: 121,760,823	H348Y	probably benign	Het
Gria1	G	T	11: 57,242,792	R499L	probably damaging	Het
Gtf2ird2	C	T	5: 134,216,547	T549M	probably damaging	Het
H2-M10.6	T	A	17: 36,814,286	V323E	probably damaging	Het
Hoxb3	G	A	11: 96,346,103	V336I	probably benign	Het
Il12b	G	A	11: 44,412,626	A327T	probably benign	Het
Inpp4a	C	A	1: 37,380,102	P588T	probably benign	Het
Kctd12	C	A	14: 102,981,591	D284Y	probably damaging	Het
Kif28	C	A	1: 179,697,772		probably null	Het
Krt2	T	C	15: 101,815,044	N332S	probably benign	Het
Lama2	G	A	10: 26,981,499	T3118I	probably benign	Het
Lgi1	T	C	19: 38,264,956	L25P	probably damaging	Het
Lhx3	T	A	2: 26,201,491	M269L	probably benign	Het
Lmtk2	A	T	5: 144,175,342	E960V	probably damaging	Het
Loxl4	A	T	19: 42,608,352	D60E	probably damaging	Het
Lrp2	T	A	2: 69,503,524	N1458Y	possibly damaging	Het
Ltn1	A	T	16: 87,427,789	S16T	probably damaging	Het
Mllt6	G	A	11: 97,678,536	A875T	possibly damaging	Het
Mpp5	C	T	12: 78,817,310	H216Y	probably benign	Het
Mrgprb4	A	T	7: 48,198,826	I118N	probably damaging	Het
Mrps7	A	G	11: 115,604,881	T82A	possibly damaging	Het
Mug2	A	G	6: 122,079,606	E1170G	probably benign	Het
Nav2	A	G	7: 49,458,167	H647R	probably benign	Het
Nbeal2	T	C	9: 110,625,147	Y2710C	probably damaging	Het
Ndc1	A	T	4: 107,411,198	I644L	possibly damaging	Het
Olfr952	A	T	9: 39,426,712	Y120N	probably damaging	Het
Padi4	A	G	4: 140,756,473	M352T	possibly damaging	Het
Pcdhgc3	C	A	18: 37,806,937	D130E	probably damaging	Het
Pde6a	A	T	18: 61,284,092		probably null	Het
Pdpn	C	T	4: 143,299,222	G12R	probably damaging	Het
Pot1a	A	T	6: 25,771,621	D200E	probably benign	Het
Ppa1	A	T	10: 61,667,652	D236V	probably benign	Het
Ptprn2	T	A	12: 116,859,119	S273T	probably benign	Het
Rgl1	T	C	1: 152,519,172	N750S	probably damaging	Het
Rinl	A	G	7: 28,796,940	N449D	probably benign	Het
Samd8	T	A	14: 21,775,025	H79Q	probably benign	Het
Scn11a	T	C	9: 119,754,867	I1561V	probably benign	Het
Slc39a12	T	C	2: 14,396,127	L105P	probably benign	Het
Slc7a12	A	T	3: 14,481,140		probably null	Het
Slco1a4	A	G	6: 141,817,820	I390T	possibly damaging	Het
Snta1	T	C	2: 154,377,182	N411S	probably benign	Het
Srgap2	T	C	1: 131,349,541	T323A	probably benign	Het
Ssh2	G	T	11: 77,453,465	V759L	probably benign	Het
St5	A	C	7: 109,556,888	D218E	probably benign	Het
Swap70	G	T	7: 110,269,981	R327L	probably damaging	Het
Tbc1d4	C	A	14: 101,458,770	C914F	probably benign	Het
Tbx3	A	G	5: 119,674,067	D144G	probably damaging	Het
Tgfbr2	T	C	9: 116,110,144	K205R	possibly damaging	Het
Tmem94	A	T	11: 115,791,031		probably null	Het
Usf3	T	A	16: 44,221,105	F1983I	probably damaging	Het
Ush2a	T	A	1: 188,399,871	C763*	probably null	Het
Vmn1r115	A	C	7: 20,844,715	L91V	probably damaging	Het
Vmn1r201	A	T	13: 22,475,329	I238F	possibly damaging	Het
Vmn1r28	T	A	6: 58,265,491	S106R	probably damaging	Het
Vmn1r82	T	C	7: 12,305,085	V95A	probably damaging	Het
Vrk3	A	T	7: 44,769,611	N371I	possibly damaging	Het
Wnt8b	C	A	19: 44,511,643	A223E	probably benign	Het
Xirp2	T	C	2: 67,505,577		probably null	Het
Xpo7	T	C	14: 70,682,803	N642S	probably benign	Het
Ythdc1	G	A	5: 86,828,094	R520H	possibly damaging	Het
Zfp367	T	C	13: 64,135,390	E316G	probably damaging	Het
Zfp488	T	A	14: 33,970,794	R137S	possibly damaging	Het
Zfp532	G	T	18: 65,656,471	V994L	probably benign	Het

Other mutations in Rasgrf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Rasgrf2	APN	13	92022917	splice site	probably benign
IGL01358:Rasgrf2	APN	13	91982630	missense	probably benign	0.23
IGL01666:Rasgrf2	APN	13	92038210	missense	probably damaging	1.00
IGL01930:Rasgrf2	APN	13	91982738	missense	probably damaging	0.98
IGL02230:Rasgrf2	APN	13	91988026	missense	probably damaging	1.00
IGL02630:Rasgrf2	APN	13	92131392	missense	probably damaging	1.00
IGL02690:Rasgrf2	APN	13	92030765	missense	probably damaging	1.00
IGL02943:Rasgrf2	APN	13	91983633	missense	probably damaging	1.00
IGL03067:Rasgrf2	APN	13	92022905	missense	probably damaging	0.97
IGL03342:Rasgrf2	APN	13	91987979	missense	probably damaging	1.00
IGL03405:Rasgrf2	APN	13	91896051	missense	probably damaging	1.00
R0620:Rasgrf2	UTSW	13	91919817	splice site	probably benign
R0632:Rasgrf2	UTSW	13	91972274	missense	probably benign	0.00
R0894:Rasgrf2	UTSW	13	91982771	missense	probably damaging	1.00
R1354:Rasgrf2	UTSW	13	92028666	missense	probably damaging	1.00
R1400:Rasgrf2	UTSW	13	91887689	missense	probably damaging	1.00
R1437:Rasgrf2	UTSW	13	92030888	missense	probably damaging	1.00
R1443:Rasgrf2	UTSW	13	91983676	missense	probably damaging	1.00
R1522:Rasgrf2	UTSW	13	91896086	missense	probably benign	0.00
R1553:Rasgrf2	UTSW	13	91890664	missense	probably damaging	1.00
R1613:Rasgrf2	UTSW	13	91902621	missense	probably damaging	1.00
R1883:Rasgrf2	UTSW	13	91969030	missense	probably benign
R1934:Rasgrf2	UTSW	13	91983706	splice site	probably null
R1990:Rasgrf2	UTSW	13	92035965	missense	probably damaging	1.00
R2037:Rasgrf2	UTSW	13	91902629	missense	probably damaging	0.99
R2043:Rasgrf2	UTSW	13	92030843	missense	possibly damaging	0.91
R2135:Rasgrf2	UTSW	13	91972255	missense	probably benign
R2193:Rasgrf2	UTSW	13	92023713	splice site	probably null
R2406:Rasgrf2	UTSW	13	91972240	missense	probably benign
R3055:Rasgrf2	UTSW	13	92029075	missense	probably damaging	1.00
R3916:Rasgrf2	UTSW	13	92030788	missense	probably damaging	1.00
R3954:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R3955:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R3956:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R4133:Rasgrf2	UTSW	13	91982654	missense	possibly damaging	0.59
R4177:Rasgrf2	UTSW	13	91890598	missense	probably damaging	1.00
R4178:Rasgrf2	UTSW	13	91890598	missense	probably damaging	1.00
R4357:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4358:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4359:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4439:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4440:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4441:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4564:Rasgrf2	UTSW	13	91885654	nonsense	probably null
R4576:Rasgrf2	UTSW	13	91896410	missense	possibly damaging	0.58
R4590:Rasgrf2	UTSW	13	92038281	missense	probably damaging	1.00
R4718:Rasgrf2	UTSW	13	91990830	critical splice donor site	probably null
R4778:Rasgrf2	UTSW	13	91983661	missense	probably damaging	0.99
R4790:Rasgrf2	UTSW	13	91988016	missense	probably damaging	1.00
R4808:Rasgrf2	UTSW	13	92023682	missense	probably damaging	1.00
R5151:Rasgrf2	UTSW	13	91896036	missense	probably damaging	1.00
R5286:Rasgrf2	UTSW	13	92131433	missense	possibly damaging	0.94
R5902:Rasgrf2	UTSW	13	91919892	missense	probably damaging	1.00
R6264:Rasgrf2	UTSW	13	92030785	missense	probably damaging	1.00
R6369:Rasgrf2	UTSW	13	92131446	missense	probably benign
R6428:Rasgrf2	UTSW	13	91987981	missense	probably damaging	1.00
R6595:Rasgrf2	UTSW	13	92030853	missense	probably damaging	1.00
R6619:Rasgrf2	UTSW	13	92028519	missense	probably damaging	1.00
R6988:Rasgrf2	UTSW	13	91885635	missense	probably benign	0.02
R7026:Rasgrf2	UTSW	13	91983613	missense	probably damaging	1.00
R7038:Rasgrf2	UTSW	13	91982833	missense	possibly damaging	0.95
R7045:Rasgrf2	UTSW	13	92022592	intron	probably benign
R7056:Rasgrf2	UTSW	13	92030695	missense	probably damaging	0.99
R7058:Rasgrf2	UTSW	13	91886402	missense	probably damaging	0.99
R7256:Rasgrf2	UTSW	13	91884518	nonsense	probably null
R7392:Rasgrf2	UTSW	13	91893737	missense
R7469:Rasgrf2	UTSW	13	92029022	critical splice donor site	probably null
R7618:Rasgrf2	UTSW	13	91987966	missense
R7641:Rasgrf2	UTSW	13	92131406	missense	possibly damaging	0.65
R7674:Rasgrf2	UTSW	13	92131406	missense	possibly damaging	0.65
R7784:Rasgrf2	UTSW	13	91896082	missense
R7962:Rasgrf2	UTSW	13	92030792	missense	probably damaging	0.99
R8056:Rasgrf2	UTSW	13	92030813	missense	probably damaging	0.97
R8218:Rasgrf2	UTSW	13	91982677	missense
R8796:Rasgrf2	UTSW	13	91890566	missense
R8913:Rasgrf2	UTSW	13	92022526	missense	probably benign	0.05
R8971:Rasgrf2	UTSW	13	92021717	missense	possibly damaging	0.80
R9020:Rasgrf2	UTSW	13	92028638	missense	possibly damaging	0.93
R9487:Rasgrf2	UTSW	13	92131251	missense	probably benign
R9562:Rasgrf2	UTSW	13	91886350	critical splice donor site	probably null
R9712:Rasgrf2	UTSW	13	91987973	missense
R9766:Rasgrf2	UTSW	13	92023680	missense	probably damaging	1.00
R9800:Rasgrf2	UTSW	13	92131352	missense	probably damaging	0.99
X0013:Rasgrf2	UTSW	13	92030855	missense	probably damaging	1.00
X0026:Rasgrf2	UTSW	13	91902535	missense	probably damaging	0.99
Z1177:Rasgrf2	UTSW	13	91983513	missense
Z1177:Rasgrf2	UTSW	13	92022573	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CCCAGTGTCTGAGTATCAACAG -3'
(R):5'- ACCATCTGACTTTGGGGTTC -3'

Sequencing Primer
(F):5'- CAGTGGATTTACATAGTCAAGGCTG -3'
(R):5'- TTTCTGGGGCTAAAAGAGAAATTGC -3'

Posted On

2017-10-10