Incidental Mutation 'R6180:Ccser2'
ID488032
Institutional Source Beutler Lab
Gene Symbol Ccser2
Ensembl Gene ENSMUSG00000058690
Gene Namecoiled-coil serine rich 2
Synonyms1700012P13Rik, 2900054P12Rik, Gcap14
MMRRC Submission 044322-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R6180 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location36874936-36968777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36940319 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 303 (S303T)
Ref Sequence ENSEMBL: ENSMUSP00000087478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067700] [ENSMUST00000090024] [ENSMUST00000183038]
Predicted Effect probably benign
Transcript: ENSMUST00000067700
AA Change: S303T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000068550
Gene: ENSMUSG00000058690
AA Change: S303T

DomainStartEndE-ValueType
low complexity region 50 63 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
coiled coil region 157 194 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090024
AA Change: S303T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087478
Gene: ENSMUSG00000058690
AA Change: S303T

DomainStartEndE-ValueType
low complexity region 389 412 N/A INTRINSIC
low complexity region 496 506 N/A INTRINSIC
low complexity region 543 562 N/A INTRINSIC
low complexity region 603 616 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
coiled coil region 710 747 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182635
Predicted Effect probably benign
Transcript: ENSMUST00000183038
SMART Domains Protein: ENSMUSP00000138718
Gene: ENSMUSG00000058690

DomainStartEndE-ValueType
low complexity region 50 63 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
coiled coil region 157 194 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,273,258 M1142V possibly damaging Het
Adam39 A G 8: 40,826,573 N667S probably benign Het
Ap4e1 T A 2: 127,066,588 C1085* probably null Het
BC035044 A T 6: 128,885,034 probably benign Het
Capn11 T C 17: 45,630,766 D693G probably damaging Het
Cavin4 A T 4: 48,663,917 H99L possibly damaging Het
Ccdc86 T C 19: 10,948,581 K218R possibly damaging Het
Ccno T C 13: 112,989,845 S283P probably damaging Het
Cd53 T A 3: 106,767,364 N129I probably damaging Het
Cd63 G A 10: 128,912,064 probably null Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Daam2 A G 17: 49,469,666 M797T probably damaging Het
Dmgdh G A 13: 93,752,286 V811I possibly damaging Het
Dpysl4 A T 7: 139,090,334 T123S probably damaging Het
Erap1 A G 13: 74,666,226 E428G possibly damaging Het
Fam124b T A 1: 80,200,185 T366S possibly damaging Het
Fbxw22 T C 9: 109,386,679 D167G probably damaging Het
Flrt2 C T 12: 95,779,238 Q117* probably null Het
Ftsj3 A T 11: 106,253,340 probably null Het
Ggn A G 7: 29,173,049 Y618C probably damaging Het
Glis1 T A 4: 107,627,513 S402T probably benign Het
Gm13762 T G 2: 88,973,882 N3T probably damaging Het
Gm4781 T A 10: 100,396,487 noncoding transcript Het
Gm7168 T A 17: 13,948,596 I75K probably damaging Het
Gm7298 C T 6: 121,760,823 H348Y probably benign Het
Gria1 G T 11: 57,242,792 R499L probably damaging Het
Gtf2ird2 C T 5: 134,216,547 T549M probably damaging Het
H2-M10.6 T A 17: 36,814,286 V323E probably damaging Het
Hoxb3 G A 11: 96,346,103 V336I probably benign Het
Il12b G A 11: 44,412,626 A327T probably benign Het
Inpp4a C A 1: 37,380,102 P588T probably benign Het
Kctd12 C A 14: 102,981,591 D284Y probably damaging Het
Kif28 C A 1: 179,697,772 probably null Het
Krt2 T C 15: 101,815,044 N332S probably benign Het
Lama2 G A 10: 26,981,499 T3118I probably benign Het
Lgi1 T C 19: 38,264,956 L25P probably damaging Het
Lhx3 T A 2: 26,201,491 M269L probably benign Het
Lmtk2 A T 5: 144,175,342 E960V probably damaging Het
Loxl4 A T 19: 42,608,352 D60E probably damaging Het
Lrp2 T A 2: 69,503,524 N1458Y possibly damaging Het
Ltn1 A T 16: 87,427,789 S16T probably damaging Het
Mllt6 G A 11: 97,678,536 A875T possibly damaging Het
Mpp5 C T 12: 78,817,310 H216Y probably benign Het
Mrgprb4 A T 7: 48,198,826 I118N probably damaging Het
Mrps7 A G 11: 115,604,881 T82A possibly damaging Het
Mug2 A G 6: 122,079,606 E1170G probably benign Het
Nav2 A G 7: 49,458,167 H647R probably benign Het
Nbeal2 T C 9: 110,625,147 Y2710C probably damaging Het
Ndc1 A T 4: 107,411,198 I644L possibly damaging Het
Olfr952 A T 9: 39,426,712 Y120N probably damaging Het
Padi4 A G 4: 140,756,473 M352T possibly damaging Het
Pcdhgc3 C A 18: 37,806,937 D130E probably damaging Het
Pde6a A T 18: 61,284,092 probably null Het
Pdpn C T 4: 143,299,222 G12R probably damaging Het
Pot1a A T 6: 25,771,621 D200E probably benign Het
Ppa1 A T 10: 61,667,652 D236V probably benign Het
Ptprn2 T A 12: 116,859,119 S273T probably benign Het
Rasgrf2 T C 13: 92,029,101 E297G probably damaging Het
Rgl1 T C 1: 152,519,172 N750S probably damaging Het
Rinl A G 7: 28,796,940 N449D probably benign Het
Samd8 T A 14: 21,775,025 H79Q probably benign Het
Scn11a T C 9: 119,754,867 I1561V probably benign Het
Slc39a12 T C 2: 14,396,127 L105P probably benign Het
Slc7a12 A T 3: 14,481,140 probably null Het
Slco1a4 A G 6: 141,817,820 I390T possibly damaging Het
Snta1 T C 2: 154,377,182 N411S probably benign Het
Srgap2 T C 1: 131,349,541 T323A probably benign Het
Ssh2 G T 11: 77,453,465 V759L probably benign Het
St5 A C 7: 109,556,888 D218E probably benign Het
Swap70 G T 7: 110,269,981 R327L probably damaging Het
Tbc1d4 C A 14: 101,458,770 C914F probably benign Het
Tbx3 A G 5: 119,674,067 D144G probably damaging Het
Tgfbr2 T C 9: 116,110,144 K205R possibly damaging Het
Tmem94 A T 11: 115,791,031 probably null Het
Usf3 T A 16: 44,221,105 F1983I probably damaging Het
Ush2a T A 1: 188,399,871 C763* probably null Het
Vmn1r115 A C 7: 20,844,715 L91V probably damaging Het
Vmn1r201 A T 13: 22,475,329 I238F possibly damaging Het
Vmn1r28 T A 6: 58,265,491 S106R probably damaging Het
Vmn1r82 T C 7: 12,305,085 V95A probably damaging Het
Vrk3 A T 7: 44,769,611 N371I possibly damaging Het
Wnt8b C A 19: 44,511,643 A223E probably benign Het
Xirp2 T C 2: 67,505,577 probably null Het
Xpo7 T C 14: 70,682,803 N642S probably benign Het
Ythdc1 G A 5: 86,828,094 R520H possibly damaging Het
Zfp367 T C 13: 64,135,390 E316G probably damaging Het
Zfp488 T A 14: 33,970,794 R137S possibly damaging Het
Zfp532 G T 18: 65,656,471 V994L probably benign Het
Other mutations in Ccser2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Ccser2 APN 14 36940064 missense probably damaging 1.00
IGL01285:Ccser2 APN 14 36938669 missense probably damaging 1.00
IGL01622:Ccser2 APN 14 36940963 missense probably benign 0.03
IGL01623:Ccser2 APN 14 36940963 missense probably benign 0.03
IGL02322:Ccser2 APN 14 36909129 missense probably damaging 1.00
IGL02342:Ccser2 APN 14 36918605 splice site probably benign
IGL02899:Ccser2 APN 14 36940759 missense probably benign 0.39
R0433:Ccser2 UTSW 14 36918529 missense probably damaging 1.00
R0543:Ccser2 UTSW 14 36940192 missense probably benign
R0674:Ccser2 UTSW 14 36918591 missense possibly damaging 0.94
R0853:Ccser2 UTSW 14 36940410 missense probably benign 0.18
R0964:Ccser2 UTSW 14 36909008 splice site probably benign
R1748:Ccser2 UTSW 14 36896313 missense probably damaging 1.00
R1748:Ccser2 UTSW 14 36896314 nonsense probably null
R1854:Ccser2 UTSW 14 36918591 missense possibly damaging 0.94
R2405:Ccser2 UTSW 14 36938669 missense probably damaging 1.00
R2926:Ccser2 UTSW 14 36879561 missense possibly damaging 0.91
R3846:Ccser2 UTSW 14 36940288 missense probably benign
R4298:Ccser2 UTSW 14 36890380 missense possibly damaging 0.63
R4701:Ccser2 UTSW 14 36938697 missense probably damaging 1.00
R4746:Ccser2 UTSW 14 36909125 missense probably damaging 1.00
R4888:Ccser2 UTSW 14 36940386 missense probably damaging 0.98
R4959:Ccser2 UTSW 14 36940796 missense probably benign 0.00
R5020:Ccser2 UTSW 14 36940177 missense probably benign 0.00
R5179:Ccser2 UTSW 14 36879351 missense possibly damaging 0.79
R5378:Ccser2 UTSW 14 36879434 missense possibly damaging 0.65
R6011:Ccser2 UTSW 14 36879575 missense probably benign 0.17
R6057:Ccser2 UTSW 14 36941165 missense probably damaging 0.98
R6216:Ccser2 UTSW 14 36940508 missense probably damaging 1.00
R6244:Ccser2 UTSW 14 36940718 missense probably benign 0.00
R6266:Ccser2 UTSW 14 36879675 missense probably damaging 1.00
R6730:Ccser2 UTSW 14 36879086 missense probably damaging 1.00
R6862:Ccser2 UTSW 14 36940081 missense probably benign
R7025:Ccser2 UTSW 14 36940007 missense probably damaging 1.00
R7076:Ccser2 UTSW 14 36939829 missense probably benign 0.14
R7092:Ccser2 UTSW 14 36940655 missense probably benign 0.03
R7353:Ccser2 UTSW 14 36941143 missense possibly damaging 0.91
R7440:Ccser2 UTSW 14 36898217 missense possibly damaging 0.92
R7509:Ccser2 UTSW 14 36938645 missense probably damaging 1.00
R7555:Ccser2 UTSW 14 36879500 missense possibly damaging 0.65
R7770:Ccser2 UTSW 14 36926874 missense probably damaging 1.00
X0066:Ccser2 UTSW 14 36940999 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGTCATTGTCTCTTCGGTAAC -3'
(R):5'- GAGCTGTAGACCTTACAAAGCC -3'

Sequencing Primer
(F):5'- TCTTGGTCCTTACCCGGAGAG -3'
(R):5'- GCTGTAGACCTTACAAAGCCTTATC -3'
Posted On2017-10-10