Incidental Mutation 'R6181:Pgap1'
ID488050
Institutional Source Beutler Lab
Gene Symbol Pgap1
Ensembl Gene ENSMUSG00000073678
Gene Namepost-GPI attachment to proteins 1
SynonymsPGAP1, D230012E17Rik, oto, 5033403E17Rik, 9030223K07Rik
MMRRC Submission 044323-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.862) question?
Stock #R6181 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location54472994-54557684 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54512777 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 499 (G499R)
Ref Sequence ENSEMBL: ENSMUSP00000095346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097739]
Predicted Effect probably benign
Transcript: ENSMUST00000097739
AA Change: G499R

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000095346
Gene: ENSMUSG00000073678
AA Change: G499R

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:PGAP1 82 302 7.2e-83 PFAM
transmembrane domain 597 619 N/A INTRINSIC
transmembrane domain 678 700 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
transmembrane domain 819 838 N/A INTRINSIC
low complexity region 854 866 N/A INTRINSIC
low complexity region 871 884 N/A INTRINSIC
transmembrane domain 902 921 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions early in the glycosylphosphatidylinositol (GPI) biosynthetic pathway, catalyzing the inositol deacylation of GPI. The encoded protein is required for the production of GPI that can attach to proteins, and this may be an important factor in the transport of GPI-anchored proteins from the endoplasmic reticulum to the Golgi. Defects in this gene are a cause of mental retardation, autosomal recessive 42. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mutations in this gene result in a variety of forebrain, eye, jaw, craniofacial, ear, and vertebra defects that are background sensitive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik A G 5: 31,488,055 E384G probably damaging Het
Akr1b7 A G 6: 34,415,378 H42R possibly damaging Het
Ankrd26 T A 6: 118,548,877 H369L probably benign Het
Ano7 T C 1: 93,395,359 S474P probably damaging Het
Aox3 T C 1: 58,158,946 V639A probably benign Het
Arhgef2 T A 3: 88,635,620 V358E probably damaging Het
BC017158 A G 7: 128,297,460 probably null Het
Brpf3 A G 17: 28,810,581 Y505C probably damaging Het
Casd1 A G 6: 4,619,331 T120A probably damaging Het
Clasp1 T G 1: 118,419,817 S32A probably benign Het
Clca2 A T 3: 145,090,708 L246* probably null Het
Clcn7 A G 17: 25,151,728 I353V possibly damaging Het
Cluap1 T A 16: 3,933,744 D322E probably benign Het
Cmtm4 A C 8: 104,356,365 probably null Het
Cntnap2 C T 6: 46,759,808 P723S probably damaging Het
Col6a3 T A 1: 90,816,374 T84S possibly damaging Het
Corin A G 5: 72,372,096 probably null Het
Cubn G A 2: 13,349,876 T1903I probably benign Het
Cyp27b1 A C 10: 127,050,410 D320A probably damaging Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Dennd2a T C 6: 39,485,620 K652R probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock1 T A 7: 135,158,522 M1638K probably damaging Het
Eya1 T C 1: 14,302,872 S8G probably damaging Het
Fam193a T A 5: 34,443,540 probably null Het
Fam208a T A 14: 27,472,278 M1145K probably benign Het
Fbxw11 T A 11: 32,742,575 N515K probably benign Het
Gm11639 T C 11: 104,831,333 S1924P probably benign Het
Gm13083 T A 4: 143,616,258 probably null Het
Gm609 A G 16: 45,417,897 S185P probably benign Het
Gm6408 T C 5: 146,483,772 V154A possibly damaging Het
Guf1 A G 5: 69,561,716 Y235C probably damaging Het
Hnrnpul2 C T 19: 8,823,232 S224L possibly damaging Het
Igkv8-19 T A 6: 70,340,984 D86V probably damaging Het
Iqcf1 A T 9: 106,501,975 D61V probably damaging Het
Lrp5 T C 19: 3,628,427 D476G probably damaging Het
Luzp1 A G 4: 136,543,267 T934A probably benign Het
Mboat7 A T 7: 3,683,885 Y319N probably benign Het
Mdn1 A G 4: 32,715,953 E2045G probably damaging Het
Mfsd14b T C 13: 65,112,584 R12G probably benign Het
Micall2 T A 5: 139,716,751 T246S probably benign Het
Npepps A G 11: 97,242,004 V299A probably damaging Het
Olfr1381 T A 11: 49,552,293 V182D probably damaging Het
P2ry13 A G 3: 59,209,907 V150A probably benign Het
Pdc T C 1: 150,333,270 I168T probably damaging Het
Pde8b C T 13: 95,086,808 E313K probably benign Het
Ppp1r15b T A 1: 133,132,523 C259* probably null Het
Ptgs1 A G 2: 36,251,119 E526G probably damaging Het
Ptpn21 A G 12: 98,699,999 L271P probably damaging Het
Rbm47 T C 5: 66,026,490 T257A possibly damaging Het
Rfc3 C T 5: 151,647,520 D104N probably damaging Het
Rhobtb3 A G 13: 75,910,689 I330T probably benign Het
Rnf207 T C 4: 152,308,848 T570A probably benign Het
Sbpl T C 17: 23,953,492 H151R probably damaging Het
Sstr3 T C 15: 78,539,461 D362G probably benign Het
St7 T C 6: 17,694,364 probably null Het
Tdrd6 A G 17: 43,628,897 V420A probably damaging Het
Tet2 C A 3: 133,487,759 E305* probably null Het
Tmem209 A T 6: 30,505,971 V68E probably damaging Het
Tmod4 A T 3: 95,127,807 I208F probably damaging Het
Tpo G A 12: 30,131,885 L4F probably benign Het
Urb1 T C 16: 90,779,094 H858R probably benign Het
Utrn A G 10: 12,739,456 W324R probably damaging Het
V1rd19 T A 7: 24,003,215 F35L possibly damaging Het
Vmn1r170 C A 7: 23,606,267 N31K probably damaging Het
Vmn1r192 T A 13: 22,187,282 Y256F probably damaging Het
Vmn2r124 T C 17: 18,073,757 I702T possibly damaging Het
Vmn2r96 G A 17: 18,583,864 A459T probably benign Het
Vwf G T 6: 125,566,146 A132S probably damaging Het
Zfp202 G A 9: 40,207,342 G17E probably damaging Het
Zfp608 A G 18: 54,895,628 S1238P possibly damaging Het
Zfp804a G T 2: 82,257,142 M438I probably damaging Het
Zgrf1 G A 3: 127,587,941 G246S probably damaging Het
Zwint T C 10: 72,656,599 V115A probably benign Het
Other mutations in Pgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Pgap1 APN 1 54492021 splice site probably benign
IGL01111:Pgap1 APN 1 54530943 missense probably benign 0.17
IGL01406:Pgap1 APN 1 54533414 splice site probably null
IGL01592:Pgap1 APN 1 54521311 missense probably damaging 1.00
IGL02005:Pgap1 APN 1 54551055 missense probably damaging 0.99
IGL02026:Pgap1 APN 1 54494819 missense probably benign 0.05
IGL02086:Pgap1 APN 1 54547988 missense probably damaging 1.00
IGL02354:Pgap1 APN 1 54512816 missense probably benign 0.02
IGL02361:Pgap1 APN 1 54512816 missense probably benign 0.02
IGL02995:Pgap1 APN 1 54493350 missense probably benign 0.19
IGL03012:Pgap1 APN 1 54533413 splice site probably benign
R0044:Pgap1 UTSW 1 54493368 missense probably damaging 1.00
R0109:Pgap1 UTSW 1 54494825 missense probably damaging 1.00
R0109:Pgap1 UTSW 1 54494825 missense probably damaging 1.00
R0241:Pgap1 UTSW 1 54535951 splice site probably null
R0241:Pgap1 UTSW 1 54535951 splice site probably null
R0352:Pgap1 UTSW 1 54486458 splice site probably benign
R1297:Pgap1 UTSW 1 54528523 missense possibly damaging 0.94
R1429:Pgap1 UTSW 1 54494861 missense probably benign 0.01
R1465:Pgap1 UTSW 1 54528555 missense probably benign 0.11
R1465:Pgap1 UTSW 1 54528555 missense probably benign 0.11
R1542:Pgap1 UTSW 1 54492090 missense probably benign 0.16
R1816:Pgap1 UTSW 1 54492057 missense probably damaging 0.99
R1817:Pgap1 UTSW 1 54535969 missense probably benign 0.15
R1905:Pgap1 UTSW 1 54511961 missense probably benign 0.26
R2006:Pgap1 UTSW 1 54551061 missense possibly damaging 0.76
R3551:Pgap1 UTSW 1 54530143 missense possibly damaging 0.89
R3833:Pgap1 UTSW 1 54557465 missense probably damaging 0.99
R3901:Pgap1 UTSW 1 54493348 missense probably benign
R4487:Pgap1 UTSW 1 54528592 missense probably benign 0.26
R4874:Pgap1 UTSW 1 54530137 missense probably damaging 0.96
R5184:Pgap1 UTSW 1 54481856 missense probably damaging 1.00
R6212:Pgap1 UTSW 1 54514893 missense probably damaging 0.99
R6269:Pgap1 UTSW 1 54548008 nonsense probably null
R6525:Pgap1 UTSW 1 54481889 missense probably benign 0.00
R6944:Pgap1 UTSW 1 54530161 missense probably damaging 1.00
R7214:Pgap1 UTSW 1 54543061 missense possibly damaging 0.47
R7256:Pgap1 UTSW 1 54493207 critical splice donor site probably null
R7290:Pgap1 UTSW 1 54548066 missense possibly damaging 0.45
R7356:Pgap1 UTSW 1 54530134 missense probably benign 0.10
R7525:Pgap1 UTSW 1 54530922 missense probably benign 0.26
R7602:Pgap1 UTSW 1 54543186 missense probably damaging 1.00
R7897:Pgap1 UTSW 1 54551008 missense probably damaging 1.00
R8278:Pgap1 UTSW 1 54490271 missense probably benign
X0025:Pgap1 UTSW 1 54481870 missense probably benign 0.26
X0060:Pgap1 UTSW 1 54536034 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGCTGACCACGTTGAC -3'
(R):5'- CTTCAGTCTCAGCTTGCACTGG -3'

Sequencing Primer
(F):5'- GCTGACCACGTTGACTTTAAAAGC -3'
(R):5'- AGCTTGCACTGGCCCTC -3'
Posted On2017-10-10