Incidental Mutation 'R6181:Cubn'
ID488057
Institutional Source Beutler Lab
Gene Symbol Cubn
Ensembl Gene ENSMUSG00000026726
Gene Namecubilin (intrinsic factor-cobalamin receptor)
SynonymsD2Wsu88e
MMRRC Submission 044323-MU
Accession Numbers

Genbank: NM_001081084; MGI: 1931256

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6181 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location13276338-13491813 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13349876 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1903 (T1903I)
Ref Sequence ENSEMBL: ENSMUSP00000089009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091436]
Predicted Effect probably benign
Transcript: ENSMUST00000091436
AA Change: T1903I

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000089009
Gene: ENSMUSG00000026726
AA Change: T1903I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 132 165 2.14e-5 SMART
EGF_CA 167 208 1.95e-8 SMART
EGF 213 258 2.85e-1 SMART
EGF_CA 260 301 2.66e-10 SMART
EGF_CA 302 345 7.07e-6 SMART
EGF 349 393 1.01e-1 SMART
EGF 398 430 3.73e-5 SMART
EGF_CA 432 468 8.63e-10 SMART
CUB 474 586 4.4e-21 SMART
CUB 590 702 3.82e-39 SMART
CUB 708 816 3.66e-18 SMART
CUB 817 928 3.09e-25 SMART
CUB 932 1042 1.29e-36 SMART
CUB 1048 1161 3.46e-37 SMART
CUB 1165 1277 7.24e-40 SMART
CUB 1278 1389 8.33e-31 SMART
CUB 1391 1506 3.08e-43 SMART
CUB 1510 1619 1.9e-34 SMART
CUB 1620 1734 7.24e-40 SMART
CUB 1738 1850 6.02e-37 SMART
CUB 1852 1963 1.57e-26 SMART
CUB 1978 2091 3.46e-28 SMART
CUB 2092 2213 2.88e-34 SMART
CUB 2217 2334 4.13e-35 SMART
CUB 2336 2448 3.1e-39 SMART
CUB 2452 2565 5.37e-34 SMART
CUB 2570 2687 3e-23 SMART
CUB 2689 2801 3.1e-39 SMART
CUB 2805 2919 2.36e-21 SMART
CUB 2920 3035 6.18e-25 SMART
CUB 3037 3150 5.16e-36 SMART
CUB 3157 3274 1.68e-35 SMART
CUB 3278 3393 7.17e-12 SMART
CUB 3395 3507 2.49e-29 SMART
CUB 3511 3623 2.4e-22 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, yolk sac and allantoic vasculature defects, embryonic and visceral endoderm defects, and lack somites. Heterozygotes display incomplete penetrance of premature death. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik A G 5: 31,488,055 E384G probably damaging Het
Akr1b7 A G 6: 34,415,378 H42R possibly damaging Het
Ankrd26 T A 6: 118,548,877 H369L probably benign Het
Ano7 T C 1: 93,395,359 S474P probably damaging Het
Aox3 T C 1: 58,158,946 V639A probably benign Het
Arhgef2 T A 3: 88,635,620 V358E probably damaging Het
BC017158 A G 7: 128,297,460 probably null Het
Brpf3 A G 17: 28,810,581 Y505C probably damaging Het
Casd1 A G 6: 4,619,331 T120A probably damaging Het
Clasp1 T G 1: 118,419,817 S32A probably benign Het
Clca2 A T 3: 145,090,708 L246* probably null Het
Clcn7 A G 17: 25,151,728 I353V possibly damaging Het
Cluap1 T A 16: 3,933,744 D322E probably benign Het
Cmtm4 A C 8: 104,356,365 probably null Het
Cntnap2 C T 6: 46,759,808 P723S probably damaging Het
Col6a3 T A 1: 90,816,374 T84S possibly damaging Het
Corin A G 5: 72,372,096 probably null Het
Cyp27b1 A C 10: 127,050,410 D320A probably damaging Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Dennd2a T C 6: 39,485,620 K652R probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock1 T A 7: 135,158,522 M1638K probably damaging Het
Eya1 T C 1: 14,302,872 S8G probably damaging Het
Fam193a T A 5: 34,443,540 probably null Het
Fam208a T A 14: 27,472,278 M1145K probably benign Het
Fbxw11 T A 11: 32,742,575 N515K probably benign Het
Gm11639 T C 11: 104,831,333 S1924P probably benign Het
Gm13083 T A 4: 143,616,258 probably null Het
Gm609 A G 16: 45,417,897 S185P probably benign Het
Gm6408 T C 5: 146,483,772 V154A possibly damaging Het
Guf1 A G 5: 69,561,716 Y235C probably damaging Het
Hnrnpul2 C T 19: 8,823,232 S224L possibly damaging Het
Igkv8-19 T A 6: 70,340,984 D86V probably damaging Het
Iqcf1 A T 9: 106,501,975 D61V probably damaging Het
Lrp5 T C 19: 3,628,427 D476G probably damaging Het
Luzp1 A G 4: 136,543,267 T934A probably benign Het
Mboat7 A T 7: 3,683,885 Y319N probably benign Het
Mdn1 A G 4: 32,715,953 E2045G probably damaging Het
Mfsd14b T C 13: 65,112,584 R12G probably benign Het
Micall2 T A 5: 139,716,751 T246S probably benign Het
Npepps A G 11: 97,242,004 V299A probably damaging Het
Olfr1381 T A 11: 49,552,293 V182D probably damaging Het
P2ry13 A G 3: 59,209,907 V150A probably benign Het
Pdc T C 1: 150,333,270 I168T probably damaging Het
Pde8b C T 13: 95,086,808 E313K probably benign Het
Pgap1 C T 1: 54,512,777 G499R probably benign Het
Ppp1r15b T A 1: 133,132,523 C259* probably null Het
Ptgs1 A G 2: 36,251,119 E526G probably damaging Het
Ptpn21 A G 12: 98,699,999 L271P probably damaging Het
Rbm47 T C 5: 66,026,490 T257A possibly damaging Het
Rfc3 C T 5: 151,647,520 D104N probably damaging Het
Rhobtb3 A G 13: 75,910,689 I330T probably benign Het
Rnf207 T C 4: 152,308,848 T570A probably benign Het
Sbpl T C 17: 23,953,492 H151R probably damaging Het
Sstr3 T C 15: 78,539,461 D362G probably benign Het
St7 T C 6: 17,694,364 probably null Het
Tdrd6 A G 17: 43,628,897 V420A probably damaging Het
Tet2 C A 3: 133,487,759 E305* probably null Het
Tmem209 A T 6: 30,505,971 V68E probably damaging Het
Tmod4 A T 3: 95,127,807 I208F probably damaging Het
Tpo G A 12: 30,131,885 L4F probably benign Het
Urb1 T C 16: 90,779,094 H858R probably benign Het
Utrn A G 10: 12,739,456 W324R probably damaging Het
V1rd19 T A 7: 24,003,215 F35L possibly damaging Het
Vmn1r170 C A 7: 23,606,267 N31K probably damaging Het
Vmn1r192 T A 13: 22,187,282 Y256F probably damaging Het
Vmn2r124 T C 17: 18,073,757 I702T possibly damaging Het
Vmn2r96 G A 17: 18,583,864 A459T probably benign Het
Vwf G T 6: 125,566,146 A132S probably damaging Het
Zfp202 G A 9: 40,207,342 G17E probably damaging Het
Zfp608 A G 18: 54,895,628 S1238P possibly damaging Het
Zfp804a G T 2: 82,257,142 M438I probably damaging Het
Zgrf1 G A 3: 127,587,941 G246S probably damaging Het
Zwint T C 10: 72,656,599 V115A probably benign Het
Other mutations in Cubn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cubn APN 2 13491820 unclassified probably benign
IGL00228:Cubn APN 2 13456697 missense probably damaging 1.00
IGL00231:Cubn APN 2 13381849 missense possibly damaging 0.89
IGL00327:Cubn APN 2 13427056 missense possibly damaging 0.73
IGL00470:Cubn APN 2 13278418 missense probably benign 0.00
IGL00519:Cubn APN 2 13282919 missense probably benign 0.00
IGL00562:Cubn APN 2 13294230 missense probably benign 0.01
IGL00678:Cubn APN 2 13467710 missense possibly damaging 0.47
IGL00834:Cubn APN 2 13381927 missense probably damaging 1.00
IGL00946:Cubn APN 2 13456623 missense probably damaging 0.98
IGL00971:Cubn APN 2 13278408 missense possibly damaging 0.77
IGL01124:Cubn APN 2 13478093 missense possibly damaging 0.62
IGL01287:Cubn APN 2 13310566 missense probably damaging 1.00
IGL01410:Cubn APN 2 13465908 missense probably benign 0.31
IGL01418:Cubn APN 2 13284041 missense probably benign 0.01
IGL01450:Cubn APN 2 13350862 splice site probably benign
IGL01534:Cubn APN 2 13465933 nonsense probably null
IGL01584:Cubn APN 2 13308661 splice site probably benign
IGL01595:Cubn APN 2 13325216 missense probably benign 0.05
IGL01625:Cubn APN 2 13306274 missense possibly damaging 0.76
IGL01732:Cubn APN 2 13489936 nonsense probably null
IGL01972:Cubn APN 2 13446072 missense possibly damaging 0.90
IGL02027:Cubn APN 2 13287594 missense probably damaging 1.00
IGL02033:Cubn APN 2 13339846 missense probably damaging 0.98
IGL02124:Cubn APN 2 13381837 missense probably damaging 0.99
IGL02335:Cubn APN 2 13427834 splice site probably null
IGL02491:Cubn APN 2 13321228 missense probably damaging 1.00
IGL02686:Cubn APN 2 13325226 missense possibly damaging 0.92
IGL02707:Cubn APN 2 13446032 missense probably damaging 0.99
IGL02746:Cubn APN 2 13445040 missense probably damaging 1.00
IGL02873:Cubn APN 2 13294370 missense probably benign 0.07
IGL02897:Cubn APN 2 13318312 missense possibly damaging 0.55
IGL03078:Cubn APN 2 13287094 missense possibly damaging 0.87
IGL03245:Cubn APN 2 13355689 missense probably benign 0.09
IGL03289:Cubn APN 2 13426967 missense probably benign 0.00
IGL03335:Cubn APN 2 13360329 missense probably damaging 1.00
IGL03355:Cubn APN 2 13478057 splice site probably null
mellow UTSW 2 13478078 missense probably damaging 1.00
PIT4354001:Cubn UTSW 2 13468852 nonsense probably null
PIT4495001:Cubn UTSW 2 13491750 missense probably benign 0.00
R0145:Cubn UTSW 2 13306432 missense probably damaging 1.00
R0220:Cubn UTSW 2 13356709 missense probably damaging 1.00
R0254:Cubn UTSW 2 13424694 missense probably benign 0.01
R0254:Cubn UTSW 2 13440514 missense possibly damaging 0.84
R0254:Cubn UTSW 2 13476035 critical splice donor site probably null
R0360:Cubn UTSW 2 13310507 splice site probably benign
R0364:Cubn UTSW 2 13310507 splice site probably benign
R0383:Cubn UTSW 2 13430959 missense probably damaging 1.00
R0419:Cubn UTSW 2 13469763 missense possibly damaging 0.77
R0419:Cubn UTSW 2 13469764 missense possibly damaging 0.87
R0498:Cubn UTSW 2 13444267 missense probably damaging 0.99
R0560:Cubn UTSW 2 13428680 missense probably damaging 1.00
R0615:Cubn UTSW 2 13360252 splice site probably null
R0735:Cubn UTSW 2 13491689 splice site probably benign
R0780:Cubn UTSW 2 13456613 missense probably damaging 1.00
R0899:Cubn UTSW 2 13362328 missense possibly damaging 0.54
R1118:Cubn UTSW 2 13336242 missense possibly damaging 0.78
R1182:Cubn UTSW 2 13445000 missense probably damaging 0.98
R1439:Cubn UTSW 2 13287568 missense probably damaging 0.96
R1450:Cubn UTSW 2 13360319 missense probably damaging 1.00
R1464:Cubn UTSW 2 13325288 missense possibly damaging 0.87
R1464:Cubn UTSW 2 13325288 missense possibly damaging 0.87
R1476:Cubn UTSW 2 13476120 missense probably benign 0.04
R1508:Cubn UTSW 2 13427105 missense probably benign 0.25
R1532:Cubn UTSW 2 13287661 missense probably damaging 1.00
R1562:Cubn UTSW 2 13427967 missense probably damaging 1.00
R1598:Cubn UTSW 2 13469789 missense probably benign 0.00
R1761:Cubn UTSW 2 13489317 critical splice donor site probably null
R1862:Cubn UTSW 2 13308561 missense probably damaging 1.00
R1874:Cubn UTSW 2 13323002 missense probably damaging 1.00
R1923:Cubn UTSW 2 13310526 missense probably damaging 1.00
R1944:Cubn UTSW 2 13278538 missense probably benign 0.01
R1960:Cubn UTSW 2 13340017 splice site probably null
R2021:Cubn UTSW 2 13308549 missense probably benign 0.09
R2137:Cubn UTSW 2 13336167 missense probably benign 0.01
R2138:Cubn UTSW 2 13444378 missense probably damaging 0.99
R2139:Cubn UTSW 2 13336167 missense probably benign 0.01
R2179:Cubn UTSW 2 13318242 missense possibly damaging 0.85
R2328:Cubn UTSW 2 13404080 nonsense probably null
R2369:Cubn UTSW 2 13491217 missense probably damaging 1.00
R2428:Cubn UTSW 2 13476150 missense probably damaging 1.00
R2435:Cubn UTSW 2 13318272 missense probably damaging 1.00
R2567:Cubn UTSW 2 13278356 splice site probably null
R2850:Cubn UTSW 2 13322953 missense probably damaging 1.00
R2853:Cubn UTSW 2 13430834 missense probably benign 0.00
R2893:Cubn UTSW 2 13358139 missense possibly damaging 0.61
R3107:Cubn UTSW 2 13362347 missense possibly damaging 0.73
R3109:Cubn UTSW 2 13362347 missense possibly damaging 0.73
R3119:Cubn UTSW 2 13358162 missense possibly damaging 0.90
R3405:Cubn UTSW 2 13333508 missense probably benign 0.00
R3703:Cubn UTSW 2 13350943 missense probably damaging 1.00
R3704:Cubn UTSW 2 13350943 missense probably damaging 1.00
R3705:Cubn UTSW 2 13350943 missense probably damaging 1.00
R3764:Cubn UTSW 2 13331585 missense possibly damaging 0.79
R3792:Cubn UTSW 2 13427914 missense probably damaging 1.00
R3802:Cubn UTSW 2 13360353 missense probably benign 0.01
R3813:Cubn UTSW 2 13294325 missense probably damaging 1.00
R3845:Cubn UTSW 2 13283008 missense probably damaging 1.00
R3846:Cubn UTSW 2 13283008 missense probably damaging 1.00
R3900:Cubn UTSW 2 13286980 critical splice donor site probably null
R3921:Cubn UTSW 2 13326677 missense probably damaging 1.00
R4075:Cubn UTSW 2 13313999 missense possibly damaging 0.58
R4082:Cubn UTSW 2 13428563 intron probably benign
R4405:Cubn UTSW 2 13466030 missense probably damaging 1.00
R4615:Cubn UTSW 2 13428749 missense probably damaging 1.00
R4629:Cubn UTSW 2 13313979 splice site probably null
R4770:Cubn UTSW 2 13314767 missense possibly damaging 0.92
R4799:Cubn UTSW 2 13287024 missense possibly damaging 0.94
R4799:Cubn UTSW 2 13351058 missense probably damaging 1.00
R4812:Cubn UTSW 2 13459076 missense probably damaging 1.00
R4825:Cubn UTSW 2 13325225 missense probably damaging 1.00
R4934:Cubn UTSW 2 13489910 missense probably benign 0.06
R4967:Cubn UTSW 2 13348045 missense probably benign 0.01
R5187:Cubn UTSW 2 13287568 missense probably damaging 0.96
R5232:Cubn UTSW 2 13478202 nonsense probably null
R5305:Cubn UTSW 2 13388939 missense probably damaging 1.00
R5506:Cubn UTSW 2 13491695 splice site probably null
R5530:Cubn UTSW 2 13308523 missense probably damaging 1.00
R5531:Cubn UTSW 2 13350932 missense probably benign 0.00
R5737:Cubn UTSW 2 13388891 missense probably damaging 1.00
R5886:Cubn UTSW 2 13320023 splice site probably benign
R5923:Cubn UTSW 2 13486078 missense possibly damaging 0.73
R6032:Cubn UTSW 2 13325184 missense probably benign 0.12
R6032:Cubn UTSW 2 13325184 missense probably benign 0.12
R6084:Cubn UTSW 2 13430897 missense probably damaging 1.00
R6087:Cubn UTSW 2 13427847 missense probably damaging 1.00
R6133:Cubn UTSW 2 13308618 missense probably benign 0.29
R6301:Cubn UTSW 2 13478078 missense probably damaging 1.00
R6320:Cubn UTSW 2 13280195 missense probably damaging 1.00
R6368:Cubn UTSW 2 13430995 missense probably damaging 0.96
R6368:Cubn UTSW 2 13476123 missense probably damaging 0.98
R6383:Cubn UTSW 2 13427835 critical splice donor site probably null
R6393:Cubn UTSW 2 13355680 missense probably benign 0.08
R6408:Cubn UTSW 2 13294203 missense probably damaging 1.00
R6470:Cubn UTSW 2 13322993 missense possibly damaging 0.87
R6532:Cubn UTSW 2 13459002 missense probably benign 0.01
R6599:Cubn UTSW 2 13310673 missense possibly damaging 0.95
R6629:Cubn UTSW 2 13430872 missense probably damaging 1.00
R6641:Cubn UTSW 2 13476064 missense probably damaging 1.00
R6800:Cubn UTSW 2 13321255 missense probably damaging 1.00
R6823:Cubn UTSW 2 13445029 missense probably benign 0.21
R6847:Cubn UTSW 2 13444253 critical splice donor site probably null
R6885:Cubn UTSW 2 13318278 missense probably damaging 1.00
R6962:Cubn UTSW 2 13348029 missense probably benign 0.03
R6973:Cubn UTSW 2 13381837 missense possibly damaging 0.61
R6975:Cubn UTSW 2 13486789 missense probably damaging 0.99
R7076:Cubn UTSW 2 13306280 missense probably benign 0.00
R7076:Cubn UTSW 2 13306281 missense probably benign 0.10
R7086:Cubn UTSW 2 13319858 missense probably damaging 0.98
R7162:Cubn UTSW 2 13342498 missense probably damaging 0.96
R7203:Cubn UTSW 2 13351003 missense probably benign 0.01
R7292:Cubn UTSW 2 13424739 missense probably damaging 0.99
R7307:Cubn UTSW 2 13340332 missense probably damaging 0.99
R7329:Cubn UTSW 2 13468771 missense probably damaging 0.99
R7395:Cubn UTSW 2 13287064 missense probably damaging 1.00
R7417:Cubn UTSW 2 13426967 missense probably benign 0.00
R7429:Cubn UTSW 2 13322993 missense possibly damaging 0.87
R7430:Cubn UTSW 2 13322993 missense possibly damaging 0.87
R7443:Cubn UTSW 2 13455509 missense probably damaging 1.00
R7699:Cubn UTSW 2 13348178 missense probably benign
R7699:Cubn UTSW 2 13489917 missense possibly damaging 0.74
R7700:Cubn UTSW 2 13348178 missense probably benign
R7700:Cubn UTSW 2 13489917 missense possibly damaging 0.74
R7751:Cubn UTSW 2 13360365 missense probably damaging 1.00
R7755:Cubn UTSW 2 13280078 missense probably benign 0.11
R7759:Cubn UTSW 2 13348150 missense probably damaging 1.00
R7903:Cubn UTSW 2 13468869 missense probably damaging 0.97
R7921:Cubn UTSW 2 13424727 missense probably benign 0.22
R7988:Cubn UTSW 2 13332355 missense probably benign 0.43
R8010:Cubn UTSW 2 13336086 critical splice donor site probably null
R8020:Cubn UTSW 2 13479178 missense probably benign 0.01
R8120:Cubn UTSW 2 13331660 missense probably damaging 1.00
R8133:Cubn UTSW 2 13388848 missense probably damaging 1.00
R8185:Cubn UTSW 2 13294318 missense probably benign 0.11
R8224:Cubn UTSW 2 13349877 missense probably benign 0.16
R8289:Cubn UTSW 2 13486802 missense probably benign 0.10
R8326:Cubn UTSW 2 13306463 missense probably benign 0.01
R8331:Cubn UTSW 2 13340242 missense probably damaging 1.00
R8338:Cubn UTSW 2 13430847 missense probably benign 0.08
R8341:Cubn UTSW 2 13428724 missense probably damaging 1.00
R8358:Cubn UTSW 2 13325160 missense probably benign 0.17
R8427:Cubn UTSW 2 13428756 missense probably benign 0.00
R8432:Cubn UTSW 2 13381799 missense probably benign 0.00
R8441:Cubn UTSW 2 13427847 missense probably damaging 1.00
R8442:Cubn UTSW 2 13314044 missense probably damaging 1.00
R8520:Cubn UTSW 2 13308520 critical splice donor site probably null
X0018:Cubn UTSW 2 13458986 missense probably damaging 1.00
X0022:Cubn UTSW 2 13476076 missense probably damaging 1.00
X0026:Cubn UTSW 2 13342581 missense probably damaging 1.00
X0063:Cubn UTSW 2 13322962 missense probably damaging 1.00
YA93:Cubn UTSW 2 13383992 missense probably benign 0.21
Z1088:Cubn UTSW 2 13294229 missense probably benign 0.43
Z1176:Cubn UTSW 2 13381825 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTTTGTACAGATGACAACGAGAC -3'
(R):5'- AAGCTCATTCTTTCCAACAGTCTTG -3'

Sequencing Primer
(F):5'- TTGTACAGATGACAACGAGACAACAG -3'
(R):5'- AGGTCTGATTTACAATTCTGTTCTC -3'
Posted On2017-10-10