Mutagenetix > Incidental Mutation

Incidental Mutation 'R0524:Pfkm'

48806

Institutional Source

Beutler Lab

Gene Symbol

Pfkm

Ensembl Gene

ENSMUSG00000033065

Gene Name

phosphofructokinase, muscle

Synonyms

PFK-M, Pfk-4, PFK-A, Pfk4, Pfkx

MMRRC Submission

038717-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.729) question?

Stock #

R0524 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

98092589-98132451 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 98131607 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 700 (I700V)

Ref Sequence

ENSEMBL: ENSMUSP00000155809 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051226] [ENSMUST00000059112] [ENSMUST00000123626] [ENSMUST00000123922] [ENSMUST00000143400] [ENSMUST00000163507] [ENSMUST00000230445]

AlphaFold

P47857

Predicted Effect

probably benign
Transcript: ENSMUST00000051226
AA Change: I700V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000059801
Gene: ENSMUSG00000033065
AA Change: I700V

Domain	Start	End	E-Value	Type
Pfam:PFK	17	324	1.3e-111	PFAM
Pfam:PFK	402	687	1e-93	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000059112

SMART Domains

Protein: ENSMUSP00000057864
Gene: ENSMUSG00000048175

Domain	Start	End	E-Value	Type
Blast:ANK	20	49	5e-13	BLAST
ANK	52	81	4.5e-3	SMART
ANK	85	113	1.22e-4	SMART
ANK	117	146	1.81e-7	SMART
ANK	150	179	2.45e-4	SMART
SOCS_box	247	287	2.08e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123626

SMART Domains

Protein: ENSMUSP00000121383
Gene: ENSMUSG00000048175

Domain	Start	End	E-Value	Type
Blast:ANK	20	49	5e-13	BLAST
ANK	52	81	4.5e-3	SMART
ANK	85	113	1.22e-4	SMART
ANK	117	146	1.81e-7	SMART
ANK	150	179	2.45e-4	SMART
SOCS_box	247	287	2.08e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123922

SMART Domains

Protein: ENSMUSP00000119481
Gene: ENSMUSG00000048175

Domain	Start	End	E-Value	Type
Blast:ANK	20	49	5e-13	BLAST
ANK	52	81	4.5e-3	SMART
ANK	85	113	1.22e-4	SMART
ANK	117	146	1.81e-7	SMART
ANK	150	179	2.45e-4	SMART
SOCS_box	247	287	2.08e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000143400

SMART Domains

Protein: ENSMUSP00000115813
Gene: ENSMUSG00000048175

Domain	Start	End	E-Value	Type
Blast:ANK	20	49	5e-13	BLAST
ANK	52	81	4.5e-3	SMART
ANK	85	113	1.22e-4	SMART
ANK	117	146	1.81e-7	SMART
ANK	150	179	2.45e-4	SMART
SOCS_box	247	287	2.08e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163507
AA Change: I700V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000132803
Gene: ENSMUSG00000033065
AA Change: I700V

Domain	Start	End	E-Value	Type
Pfam:PFK	16	326	2.9e-138	PFAM
Pfam:PFK	401	688	1.8e-61	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000230445
AA Change: I700V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 99.5%
3x: 98.7%
10x: 96.4%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Three phosphofructokinase isozymes exist in humans: muscle, liver and platelet. These isozymes function as subunits of the mammalian tetramer phosphofructokinase, which catalyzes the phosphorylation of fructose-6-phosphate to fructose-1,6-bisphosphate. Tetramer composition varies depending on tissue type. This gene encodes the muscle-type isozyme. Mutations in this gene have been associated with glycogen storage disease type VII, also known as Tarui disease. Alternatively spliced transcript variants have been described.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit abnormal glucose homeostasis. Mice homozygous for a knock-out allele exhibit premature death, exercise intolerance, abnormal glucose homeostasis, cardiomegaly, splenomegaly, and abnormal muscle morphology and physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd3	CGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGA	1: 180,747,059		probably benign	Het
Adamts16	T	C	13: 70,800,894	E216G	probably benign	Het
Aoc3	C	A	11: 101,337,511	P715T	probably damaging	Het
Bnipl	T	C	3: 95,249,829	D33G	probably benign	Het
Celsr2	T	C	3: 108,401,587	H1701R	probably damaging	Het
Clca3b	T	A	3: 144,825,321	H756L	probably benign	Het
Clca4a	A	G	3: 144,969,393	W159R	probably damaging	Het
Ddx49	A	T	8: 70,296,924	I252N	probably damaging	Het
Duox2	T	C	2: 122,281,836	T1290A	possibly damaging	Het
Fam111a	T	A	19: 12,588,048	I431K	probably damaging	Het
Fam135b	A	T	15: 71,462,284	D1020E	probably benign	Het
Flii	A	G	11: 60,720,061	V514A	probably damaging	Het
Frmpd1	G	A	4: 45,256,902	V157M	probably damaging	Het
Frmpd1	A	G	4: 45,283,774	D865G	probably benign	Het
Gm6970	T	A	19: 47,170,494	K214M	unknown	Het
Gsr	G	A	8: 33,669,180		probably null	Het
Hps3	A	T	3: 20,012,776	V542E	probably damaging	Het
Kcnj5	A	G	9: 32,322,974	I15T	probably benign	Het
Kif2b	T	C	11: 91,575,724	R578G	probably benign	Het
Lamb2	A	G	9: 108,484,372	R676G	possibly damaging	Het
Mrpl40	A	G	16: 18,873,552	F94S	possibly damaging	Het
Myo7b	C	T	18: 32,013,424	V103M	possibly damaging	Het
Nmt2	T	A	2: 3,305,437	W69R	probably benign	Het
Nsd3	C	A	8: 25,700,577	Q1130K	possibly damaging	Het
Olfml1	T	C	7: 107,590,177	S150P	probably damaging	Het
Olfr123	A	T	17: 37,795,605	K54*	probably null	Het
Olfr1471	A	G	19: 13,445,864	N284S	probably damaging	Het
Pask	A	T	1: 93,310,834	W1310R	probably damaging	Het
Pcdh18	T	C	3: 49,755,642	Q408R	probably damaging	Het
Pias1	A	G	9: 62,952,178	V16A	probably damaging	Het
Pnpla8	C	T	12: 44,283,618	Q318*	probably null	Het
Ppp1cc	C	T	5: 122,172,770	R142*	probably null	Het
Pygl	T	A	12: 70,207,724	N149I	probably damaging	Het
Rapgef6	T	A	11: 54,690,284	S1285T	probably benign	Het
Rdh13	A	C	7: 4,444,297	C10W	probably damaging	Het
Rgr	A	T	14: 37,038,295	C273S	probably benign	Het
Ripk4	G	T	16: 97,755,287	Y22*	probably null	Het
Slc34a2	G	A	5: 53,064,873	W302*	probably null	Het
Smarce1	G	A	11: 99,214,062	T263M	probably damaging	Het
Sypl	C	T	12: 32,967,565	P94L	possibly damaging	Het
Tet3	A	G	6: 83,379,942	I878T	probably damaging	Het
Tmem232	A	G	17: 65,485,942	S87P	probably damaging	Het
Tmem260	A	G	14: 48,472,478	T163A	probably benign	Het
Ttn	T	C	2: 76,725,452	Y30403C	probably damaging	Het
Ubash3b	A	T	9: 41,016,608	M468K	probably benign	Het
Ulk4	A	G	9: 121,252,651		probably null	Het
Vmn1r72	A	G	7: 11,669,792	F243S	probably benign	Het
Wrap73	A	G	4: 154,145,307	Y45C	probably damaging	Het
Zfp704	T	C	3: 9,609,364	D119G	unknown	Het
Zfp719	A	G	7: 43,589,253		probably null	Het

Other mutations in Pfkm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00793:Pfkm	APN	15	98125594	missense	probably benign	0.00
IGL01843:Pfkm	APN	15	98129306	missense	possibly damaging	0.65
IGL02090:Pfkm	APN	15	98123240	critical splice donor site	probably null
IGL02624:Pfkm	APN	15	98126395	missense	probably benign	0.03
IGL02869:Pfkm	APN	15	98128242	missense	probably damaging	1.00
IGL03102:Pfkm	APN	15	98126385	missense	possibly damaging	0.86
IGL03164:Pfkm	APN	15	98131962	missense	probably damaging	1.00
IGL03188:Pfkm	APN	15	98123243	splice site	probably null
IGL03241:Pfkm	APN	15	98123180	missense	probably benign	0.02
E0374:Pfkm	UTSW	15	98123233	missense	probably damaging	1.00
R0379:Pfkm	UTSW	15	98126314	missense	probably benign	0.01
R0898:Pfkm	UTSW	15	98128230	missense	probably benign	0.09
R1086:Pfkm	UTSW	15	98131665	missense	probably benign	0.05
R1698:Pfkm	UTSW	15	98128318	missense	possibly damaging	0.95
R1886:Pfkm	UTSW	15	98127746	missense	probably damaging	1.00
R2051:Pfkm	UTSW	15	98131692	missense	probably benign	0.03
R2102:Pfkm	UTSW	15	98129290	missense	probably damaging	1.00
R2312:Pfkm	UTSW	15	98125575	missense	probably damaging	1.00
R3154:Pfkm	UTSW	15	98118209	missense	probably damaging	1.00
R3688:Pfkm	UTSW	15	98131517	missense	probably benign	0.00
R3911:Pfkm	UTSW	15	98125047	missense	probably benign	0.02
R4999:Pfkm	UTSW	15	98128242	missense	probably damaging	1.00
R5008:Pfkm	UTSW	15	98122689	missense	probably benign	0.35
R5027:Pfkm	UTSW	15	98119426	missense	possibly damaging	0.55
R5178:Pfkm	UTSW	15	98131515	missense	probably benign
R5617:Pfkm	UTSW	15	98122226	missense	possibly damaging	0.88
R5891:Pfkm	UTSW	15	98122690	nonsense	probably null
R6248:Pfkm	UTSW	15	98126379	missense	probably damaging	1.00
R7079:Pfkm	UTSW	15	98095082	missense	probably benign	0.31
R7605:Pfkm	UTSW	15	98121310	missense	probably damaging	1.00
R7979:Pfkm	UTSW	15	98128236	missense	probably damaging	1.00
R8482:Pfkm	UTSW	15	98131983	missense	probably benign	0.05
R9065:Pfkm	UTSW	15	98123799	missense	probably damaging	0.96
R9178:Pfkm	UTSW	15	98129280	missense	probably damaging	1.00
R9221:Pfkm	UTSW	15	98121307	missense	probably damaging	1.00
RF010:Pfkm	UTSW	15	98129793	missense	possibly damaging	0.78
X0020:Pfkm	UTSW	15	98112226	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGAAGCCCAACTCCCTTTGACAG -3'
(R):5'- AGGATTTTGAGGATTGGCCTCAGC -3'

Sequencing Primer
(F):5'- CAGGAATTTTGCCACTAAGATGG -3'
(R):5'- AGGATTGGCCTCAGCTTCAG -3'

Posted On

2013-06-12