Incidental Mutation 'R0524:Pfkm'
ID48806
Institutional Source Beutler Lab
Gene Symbol Pfkm
Ensembl Gene ENSMUSG00000033065
Gene Namephosphofructokinase, muscle
SynonymsPFK-M, Pfk-4, PFK-A, Pfk4, Pfkx
MMRRC Submission 038717-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.836) question?
Stock #R0524 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location98092589-98132451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98131607 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 700 (I700V)
Ref Sequence ENSEMBL: ENSMUSP00000155809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051226] [ENSMUST00000059112] [ENSMUST00000123626] [ENSMUST00000123922] [ENSMUST00000143400] [ENSMUST00000163507] [ENSMUST00000230445]
Predicted Effect probably benign
Transcript: ENSMUST00000051226
AA Change: I700V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059801
Gene: ENSMUSG00000033065
AA Change: I700V

DomainStartEndE-ValueType
Pfam:PFK 17 324 1.3e-111 PFAM
Pfam:PFK 402 687 1e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059112
SMART Domains Protein: ENSMUSP00000057864
Gene: ENSMUSG00000048175

DomainStartEndE-ValueType
Blast:ANK 20 49 5e-13 BLAST
ANK 52 81 4.5e-3 SMART
ANK 85 113 1.22e-4 SMART
ANK 117 146 1.81e-7 SMART
ANK 150 179 2.45e-4 SMART
SOCS_box 247 287 2.08e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123626
SMART Domains Protein: ENSMUSP00000121383
Gene: ENSMUSG00000048175

DomainStartEndE-ValueType
Blast:ANK 20 49 5e-13 BLAST
ANK 52 81 4.5e-3 SMART
ANK 85 113 1.22e-4 SMART
ANK 117 146 1.81e-7 SMART
ANK 150 179 2.45e-4 SMART
SOCS_box 247 287 2.08e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123922
SMART Domains Protein: ENSMUSP00000119481
Gene: ENSMUSG00000048175

DomainStartEndE-ValueType
Blast:ANK 20 49 5e-13 BLAST
ANK 52 81 4.5e-3 SMART
ANK 85 113 1.22e-4 SMART
ANK 117 146 1.81e-7 SMART
ANK 150 179 2.45e-4 SMART
SOCS_box 247 287 2.08e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143400
SMART Domains Protein: ENSMUSP00000115813
Gene: ENSMUSG00000048175

DomainStartEndE-ValueType
Blast:ANK 20 49 5e-13 BLAST
ANK 52 81 4.5e-3 SMART
ANK 85 113 1.22e-4 SMART
ANK 117 146 1.81e-7 SMART
ANK 150 179 2.45e-4 SMART
SOCS_box 247 287 2.08e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163507
AA Change: I700V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132803
Gene: ENSMUSG00000033065
AA Change: I700V

DomainStartEndE-ValueType
Pfam:PFK 16 326 2.9e-138 PFAM
Pfam:PFK 401 688 1.8e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230445
AA Change: I700V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Three phosphofructokinase isozymes exist in humans: muscle, liver and platelet. These isozymes function as subunits of the mammalian tetramer phosphofructokinase, which catalyzes the phosphorylation of fructose-6-phosphate to fructose-1,6-bisphosphate. Tetramer composition varies depending on tissue type. This gene encodes the muscle-type isozyme. Mutations in this gene have been associated with glycogen storage disease type VII, also known as Tarui disease. Alternatively spliced transcript variants have been described.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit abnormal glucose homeostasis. Mice homozygous for a knock-out allele exhibit premature death, exercise intolerance, abnormal glucose homeostasis, cardiomegaly, splenomegaly, and abnormal muscle morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,747,059 probably benign Het
Adamts16 T C 13: 70,800,894 E216G probably benign Het
Aoc3 C A 11: 101,337,511 P715T probably damaging Het
Bnipl T C 3: 95,249,829 D33G probably benign Het
Celsr2 T C 3: 108,401,587 H1701R probably damaging Het
Clca3b T A 3: 144,825,321 H756L probably benign Het
Clca4a A G 3: 144,969,393 W159R probably damaging Het
Ddx49 A T 8: 70,296,924 I252N probably damaging Het
Duox2 T C 2: 122,281,836 T1290A possibly damaging Het
Fam111a T A 19: 12,588,048 I431K probably damaging Het
Fam135b A T 15: 71,462,284 D1020E probably benign Het
Flii A G 11: 60,720,061 V514A probably damaging Het
Frmpd1 G A 4: 45,256,902 V157M probably damaging Het
Frmpd1 A G 4: 45,283,774 D865G probably benign Het
Gm6970 T A 19: 47,170,494 K214M unknown Het
Gsr G A 8: 33,669,180 probably null Het
Hps3 A T 3: 20,012,776 V542E probably damaging Het
Kcnj5 A G 9: 32,322,974 I15T probably benign Het
Kif2b T C 11: 91,575,724 R578G probably benign Het
Lamb2 A G 9: 108,484,372 R676G possibly damaging Het
Mrpl40 A G 16: 18,873,552 F94S possibly damaging Het
Myo7b C T 18: 32,013,424 V103M possibly damaging Het
Nmt2 T A 2: 3,305,437 W69R probably benign Het
Nsd3 C A 8: 25,700,577 Q1130K possibly damaging Het
Olfml1 T C 7: 107,590,177 S150P probably damaging Het
Olfr123 A T 17: 37,795,605 K54* probably null Het
Olfr1471 A G 19: 13,445,864 N284S probably damaging Het
Pask A T 1: 93,310,834 W1310R probably damaging Het
Pcdh18 T C 3: 49,755,642 Q408R probably damaging Het
Pias1 A G 9: 62,952,178 V16A probably damaging Het
Pnpla8 C T 12: 44,283,618 Q318* probably null Het
Ppp1cc C T 5: 122,172,770 R142* probably null Het
Pygl T A 12: 70,207,724 N149I probably damaging Het
Rapgef6 T A 11: 54,690,284 S1285T probably benign Het
Rdh13 A C 7: 4,444,297 C10W probably damaging Het
Rgr A T 14: 37,038,295 C273S probably benign Het
Ripk4 G T 16: 97,755,287 Y22* probably null Het
Slc34a2 G A 5: 53,064,873 W302* probably null Het
Smarce1 G A 11: 99,214,062 T263M probably damaging Het
Sypl C T 12: 32,967,565 P94L possibly damaging Het
Tet3 A G 6: 83,379,942 I878T probably damaging Het
Tmem232 A G 17: 65,485,942 S87P probably damaging Het
Tmem260 A G 14: 48,472,478 T163A probably benign Het
Ttn T C 2: 76,725,452 Y30403C probably damaging Het
Ubash3b A T 9: 41,016,608 M468K probably benign Het
Ulk4 A G 9: 121,252,651 probably null Het
Vmn1r72 A G 7: 11,669,792 F243S probably benign Het
Wrap73 A G 4: 154,145,307 Y45C probably damaging Het
Zfp704 T C 3: 9,609,364 D119G unknown Het
Zfp719 A G 7: 43,589,253 probably null Het
Other mutations in Pfkm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Pfkm APN 15 98125594 missense probably benign 0.00
IGL01843:Pfkm APN 15 98129306 missense possibly damaging 0.65
IGL02090:Pfkm APN 15 98123240 critical splice donor site probably null
IGL02624:Pfkm APN 15 98126395 missense probably benign 0.03
IGL02869:Pfkm APN 15 98128242 missense probably damaging 1.00
IGL03102:Pfkm APN 15 98126385 missense possibly damaging 0.86
IGL03164:Pfkm APN 15 98131962 missense probably damaging 1.00
IGL03188:Pfkm APN 15 98123243 splice site probably null
IGL03241:Pfkm APN 15 98123180 missense probably benign 0.02
E0374:Pfkm UTSW 15 98123233 missense probably damaging 1.00
R0379:Pfkm UTSW 15 98126314 missense probably benign 0.01
R0898:Pfkm UTSW 15 98128230 missense probably benign 0.09
R1086:Pfkm UTSW 15 98131665 missense probably benign 0.05
R1698:Pfkm UTSW 15 98128318 missense possibly damaging 0.95
R1886:Pfkm UTSW 15 98127746 missense probably damaging 1.00
R2051:Pfkm UTSW 15 98131692 missense probably benign 0.03
R2102:Pfkm UTSW 15 98129290 missense probably damaging 1.00
R2312:Pfkm UTSW 15 98125575 missense probably damaging 1.00
R3154:Pfkm UTSW 15 98118209 missense probably damaging 1.00
R3688:Pfkm UTSW 15 98131517 missense probably benign 0.00
R3911:Pfkm UTSW 15 98125047 missense probably benign 0.02
R4999:Pfkm UTSW 15 98128242 missense probably damaging 1.00
R5008:Pfkm UTSW 15 98122689 missense probably benign 0.35
R5027:Pfkm UTSW 15 98119426 missense possibly damaging 0.55
R5178:Pfkm UTSW 15 98131515 missense probably benign
R5617:Pfkm UTSW 15 98122226 missense possibly damaging 0.88
R5891:Pfkm UTSW 15 98122690 nonsense probably null
R6248:Pfkm UTSW 15 98126379 missense probably damaging 1.00
R7079:Pfkm UTSW 15 98095082 missense probably benign 0.31
R7605:Pfkm UTSW 15 98121310 missense probably damaging 1.00
RF010:Pfkm UTSW 15 98129793 missense possibly damaging 0.78
X0020:Pfkm UTSW 15 98112226 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAAGCCCAACTCCCTTTGACAG -3'
(R):5'- AGGATTTTGAGGATTGGCCTCAGC -3'

Sequencing Primer
(F):5'- CAGGAATTTTGCCACTAAGATGG -3'
(R):5'- AGGATTGGCCTCAGCTTCAG -3'
Posted On2013-06-12