Incidental Mutation 'R0524:Mrpl40'
ID48807
Institutional Source Beutler Lab
Gene Symbol Mrpl40
Ensembl Gene ENSMUSG00000022706
Gene Namemitochondrial ribosomal protein L40
SynonymsNlvcf
MMRRC Submission 038717-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R0524 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location18872018-18876862 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18873552 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 94 (F94S)
Ref Sequence ENSEMBL: ENSMUSP00000023391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004222] [ENSMUST00000023391] [ENSMUST00000119273] [ENSMUST00000120532] [ENSMUST00000128321] [ENSMUST00000144609] [ENSMUST00000153397] [ENSMUST00000190050]
Predicted Effect probably benign
Transcript: ENSMUST00000004222
SMART Domains Protein: ENSMUSP00000004222
Gene: ENSMUSG00000022702

DomainStartEndE-ValueType
WD40 1 44 1.56e-1 SMART
WD40 59 98 9.67e-7 SMART
WD40 120 159 3.58e-10 SMART
WD40 163 202 7.22e-6 SMART
WD40 212 254 9.17e1 SMART
WD40 257 313 1.54e0 SMART
WD40 319 356 2.86e0 SMART
low complexity region 405 412 N/A INTRINSIC
Pfam:HIRA_B 448 470 1.9e-10 PFAM
low complexity region 493 507 N/A INTRINSIC
low complexity region 540 556 N/A INTRINSIC
low complexity region 600 614 N/A INTRINSIC
low complexity region 626 641 N/A INTRINSIC
Pfam:Hira 761 960 2.9e-61 PFAM
low complexity region 979 989 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000023391
AA Change: F94S

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023391
Gene: ENSMUSG00000022706
AA Change: F94S

DomainStartEndE-ValueType
Pfam:MRP-L28 45 199 1.3e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119273
AA Change: F50S

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000113065
Gene: ENSMUSG00000022706
AA Change: F50S

DomainStartEndE-ValueType
Pfam:MRP-L28 1 155 6.4e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120532
SMART Domains Protein: ENSMUSP00000112614
Gene: ENSMUSG00000022702

DomainStartEndE-ValueType
WD40 15 54 9.67e-7 SMART
WD40 76 115 3.58e-10 SMART
WD40 119 158 7.22e-6 SMART
WD40 168 210 9.17e1 SMART
WD40 213 269 1.54e0 SMART
WD40 275 312 2.86e0 SMART
low complexity region 361 368 N/A INTRINSIC
Pfam:HIRA_B 404 427 1.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128321
Predicted Effect probably benign
Transcript: ENSMUST00000144609
Predicted Effect probably benign
Transcript: ENSMUST00000153397
SMART Domains Protein: ENSMUSP00000117944
Gene: ENSMUSG00000022702

DomainStartEndE-ValueType
Blast:WD40 1 40 1e-18 BLAST
SCOP:d1erja_ 7 33 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190050
SMART Domains Protein: ENSMUSP00000141101
Gene: ENSMUSG00000099908

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232123
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Deletions in this gene may contribute to the etiology of velo-cardio-facial syndrome and DiGeorge syndrome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,747,059 probably benign Het
Adamts16 T C 13: 70,800,894 E216G probably benign Het
Aoc3 C A 11: 101,337,511 P715T probably damaging Het
Bnipl T C 3: 95,249,829 D33G probably benign Het
Celsr2 T C 3: 108,401,587 H1701R probably damaging Het
Clca3b T A 3: 144,825,321 H756L probably benign Het
Clca4a A G 3: 144,969,393 W159R probably damaging Het
Ddx49 A T 8: 70,296,924 I252N probably damaging Het
Duox2 T C 2: 122,281,836 T1290A possibly damaging Het
Fam111a T A 19: 12,588,048 I431K probably damaging Het
Fam135b A T 15: 71,462,284 D1020E probably benign Het
Flii A G 11: 60,720,061 V514A probably damaging Het
Frmpd1 G A 4: 45,256,902 V157M probably damaging Het
Frmpd1 A G 4: 45,283,774 D865G probably benign Het
Gm6970 T A 19: 47,170,494 K214M unknown Het
Gsr G A 8: 33,669,180 probably null Het
Hps3 A T 3: 20,012,776 V542E probably damaging Het
Kcnj5 A G 9: 32,322,974 I15T probably benign Het
Kif2b T C 11: 91,575,724 R578G probably benign Het
Lamb2 A G 9: 108,484,372 R676G possibly damaging Het
Myo7b C T 18: 32,013,424 V103M possibly damaging Het
Nmt2 T A 2: 3,305,437 W69R probably benign Het
Nsd3 C A 8: 25,700,577 Q1130K possibly damaging Het
Olfml1 T C 7: 107,590,177 S150P probably damaging Het
Olfr123 A T 17: 37,795,605 K54* probably null Het
Olfr1471 A G 19: 13,445,864 N284S probably damaging Het
Pask A T 1: 93,310,834 W1310R probably damaging Het
Pcdh18 T C 3: 49,755,642 Q408R probably damaging Het
Pfkm A G 15: 98,131,607 I700V probably benign Het
Pias1 A G 9: 62,952,178 V16A probably damaging Het
Pnpla8 C T 12: 44,283,618 Q318* probably null Het
Ppp1cc C T 5: 122,172,770 R142* probably null Het
Pygl T A 12: 70,207,724 N149I probably damaging Het
Rapgef6 T A 11: 54,690,284 S1285T probably benign Het
Rdh13 A C 7: 4,444,297 C10W probably damaging Het
Rgr A T 14: 37,038,295 C273S probably benign Het
Ripk4 G T 16: 97,755,287 Y22* probably null Het
Slc34a2 G A 5: 53,064,873 W302* probably null Het
Smarce1 G A 11: 99,214,062 T263M probably damaging Het
Sypl C T 12: 32,967,565 P94L possibly damaging Het
Tet3 A G 6: 83,379,942 I878T probably damaging Het
Tmem232 A G 17: 65,485,942 S87P probably damaging Het
Tmem260 A G 14: 48,472,478 T163A probably benign Het
Ttn T C 2: 76,725,452 Y30403C probably damaging Het
Ubash3b A T 9: 41,016,608 M468K probably benign Het
Ulk4 A G 9: 121,252,651 probably null Het
Vmn1r72 A G 7: 11,669,792 F243S probably benign Het
Wrap73 A G 4: 154,145,307 Y45C probably damaging Het
Zfp704 T C 3: 9,609,364 D119G unknown Het
Zfp719 A G 7: 43,589,253 probably null Het
Other mutations in Mrpl40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01619:Mrpl40 APN 16 18872544 missense probably benign 0.02
IGL01649:Mrpl40 APN 16 18872579 missense probably benign 0.02
R1509:Mrpl40 UTSW 16 18875409 critical splice acceptor site probably null
R1876:Mrpl40 UTSW 16 18872474 missense probably benign 0.17
R2251:Mrpl40 UTSW 16 18875375 missense probably benign 0.03
R2252:Mrpl40 UTSW 16 18875375 missense probably benign 0.03
R2428:Mrpl40 UTSW 16 18872375 missense probably damaging 0.98
R4512:Mrpl40 UTSW 16 18872558 missense probably benign 0.02
R5877:Mrpl40 UTSW 16 18872385 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTCTATGTCAAGGGTCAGAGC -3'
(R):5'- TCCTATCCGTCCTGAGGTTGAGTG -3'

Sequencing Primer
(F):5'- TGGAGCAAAGCTGATCTAAACTC -3'
(R):5'- TGCTTGTACCCACTAGAGCAG -3'
Posted On2013-06-12