Incidental Mutation 'R6181:Micall2'
ID488075
Institutional Source Beutler Lab
Gene Symbol Micall2
Ensembl Gene ENSMUSG00000036718
Gene NameMICAL-like 2
SynonymsA930021H16Rik, Jrab, MICAL-L2
MMRRC Submission 044323-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R6181 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location139706696-139736336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139716751 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 246 (T246S)
Ref Sequence ENSEMBL: ENSMUSP00000039707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044642] [ENSMUST00000170773]
Predicted Effect probably benign
Transcript: ENSMUST00000044642
AA Change: T246S

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000039707
Gene: ENSMUSG00000036718
AA Change: T246S

DomainStartEndE-ValueType
CH 3 102 4.34e-20 SMART
LIM 187 241 1.62e-5 SMART
low complexity region 242 253 N/A INTRINSIC
low complexity region 326 344 N/A INTRINSIC
low complexity region 428 489 N/A INTRINSIC
low complexity region 502 518 N/A INTRINSIC
low complexity region 728 746 N/A INTRINSIC
low complexity region 755 770 N/A INTRINSIC
DUF3585 840 980 3.1e-63 SMART
Predicted Effect unknown
Transcript: ENSMUST00000170773
AA Change: T163S
SMART Domains Protein: ENSMUSP00000127937
Gene: ENSMUSG00000036718
AA Change: T163S

DomainStartEndE-ValueType
SCOP:d1bkra_ 1 25 9e-5 SMART
Blast:DUF3585 1 45 2e-7 BLAST
LIM 104 158 1.62e-5 SMART
low complexity region 159 170 N/A INTRINSIC
low complexity region 243 261 N/A INTRINSIC
low complexity region 345 406 N/A INTRINSIC
low complexity region 419 435 N/A INTRINSIC
low complexity region 645 663 N/A INTRINSIC
low complexity region 672 687 N/A INTRINSIC
DUF3585 757 897 3.1e-63 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik A G 5: 31,488,055 E384G probably damaging Het
Akr1b7 A G 6: 34,415,378 H42R possibly damaging Het
Ankrd26 T A 6: 118,548,877 H369L probably benign Het
Ano7 T C 1: 93,395,359 S474P probably damaging Het
Aox3 T C 1: 58,158,946 V639A probably benign Het
Arhgef2 T A 3: 88,635,620 V358E probably damaging Het
BC017158 A G 7: 128,297,460 probably null Het
Brpf3 A G 17: 28,810,581 Y505C probably damaging Het
Casd1 A G 6: 4,619,331 T120A probably damaging Het
Clasp1 T G 1: 118,419,817 S32A probably benign Het
Clca2 A T 3: 145,090,708 L246* probably null Het
Clcn7 A G 17: 25,151,728 I353V possibly damaging Het
Cluap1 T A 16: 3,933,744 D322E probably benign Het
Cmtm4 A C 8: 104,356,365 probably null Het
Cntnap2 C T 6: 46,759,808 P723S probably damaging Het
Col6a3 T A 1: 90,816,374 T84S possibly damaging Het
Corin A G 5: 72,372,096 probably null Het
Cubn G A 2: 13,349,876 T1903I probably benign Het
Cyp27b1 A C 10: 127,050,410 D320A probably damaging Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Dennd2a T C 6: 39,485,620 K652R probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock1 T A 7: 135,158,522 M1638K probably damaging Het
Eya1 T C 1: 14,302,872 S8G probably damaging Het
Fam193a T A 5: 34,443,540 probably null Het
Fam208a T A 14: 27,472,278 M1145K probably benign Het
Fbxw11 T A 11: 32,742,575 N515K probably benign Het
Gm11639 T C 11: 104,831,333 S1924P probably benign Het
Gm13083 T A 4: 143,616,258 probably null Het
Gm609 A G 16: 45,417,897 S185P probably benign Het
Gm6408 T C 5: 146,483,772 V154A possibly damaging Het
Guf1 A G 5: 69,561,716 Y235C probably damaging Het
Hnrnpul2 C T 19: 8,823,232 S224L possibly damaging Het
Igkv8-19 T A 6: 70,340,984 D86V probably damaging Het
Iqcf1 A T 9: 106,501,975 D61V probably damaging Het
Lrp5 T C 19: 3,628,427 D476G probably damaging Het
Luzp1 A G 4: 136,543,267 T934A probably benign Het
Mboat7 A T 7: 3,683,885 Y319N probably benign Het
Mdn1 A G 4: 32,715,953 E2045G probably damaging Het
Mfsd14b T C 13: 65,112,584 R12G probably benign Het
Npepps A G 11: 97,242,004 V299A probably damaging Het
Olfr1381 T A 11: 49,552,293 V182D probably damaging Het
P2ry13 A G 3: 59,209,907 V150A probably benign Het
Pdc T C 1: 150,333,270 I168T probably damaging Het
Pde8b C T 13: 95,086,808 E313K probably benign Het
Pgap1 C T 1: 54,512,777 G499R probably benign Het
Ppp1r15b T A 1: 133,132,523 C259* probably null Het
Ptgs1 A G 2: 36,251,119 E526G probably damaging Het
Ptpn21 A G 12: 98,699,999 L271P probably damaging Het
Rbm47 T C 5: 66,026,490 T257A possibly damaging Het
Rfc3 C T 5: 151,647,520 D104N probably damaging Het
Rhobtb3 A G 13: 75,910,689 I330T probably benign Het
Rnf207 T C 4: 152,308,848 T570A probably benign Het
Sbpl T C 17: 23,953,492 H151R probably damaging Het
Sstr3 T C 15: 78,539,461 D362G probably benign Het
St7 T C 6: 17,694,364 probably null Het
Tdrd6 A G 17: 43,628,897 V420A probably damaging Het
Tet2 C A 3: 133,487,759 E305* probably null Het
Tmem209 A T 6: 30,505,971 V68E probably damaging Het
Tmod4 A T 3: 95,127,807 I208F probably damaging Het
Tpo G A 12: 30,131,885 L4F probably benign Het
Urb1 T C 16: 90,779,094 H858R probably benign Het
Utrn A G 10: 12,739,456 W324R probably damaging Het
V1rd19 T A 7: 24,003,215 F35L possibly damaging Het
Vmn1r170 C A 7: 23,606,267 N31K probably damaging Het
Vmn1r192 T A 13: 22,187,282 Y256F probably damaging Het
Vmn2r124 T C 17: 18,073,757 I702T possibly damaging Het
Vmn2r96 G A 17: 18,583,864 A459T probably benign Het
Vwf G T 6: 125,566,146 A132S probably damaging Het
Zfp202 G A 9: 40,207,342 G17E probably damaging Het
Zfp608 A G 18: 54,895,628 S1238P possibly damaging Het
Zfp804a G T 2: 82,257,142 M438I probably damaging Het
Zgrf1 G A 3: 127,587,941 G246S probably damaging Het
Zwint T C 10: 72,656,599 V115A probably benign Het
Other mutations in Micall2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Micall2 APN 5 139717556 critical splice acceptor site probably null
IGL00496:Micall2 APN 5 139716328 missense probably benign 0.01
IGL02641:Micall2 APN 5 139719339 missense probably damaging 1.00
IGL03245:Micall2 APN 5 139719259 missense probably damaging 1.00
IGL03252:Micall2 APN 5 139716726 missense probably benign 0.01
R1214:Micall2 UTSW 5 139711641 missense probably damaging 0.97
R1468:Micall2 UTSW 5 139719342 missense probably damaging 1.00
R1468:Micall2 UTSW 5 139719342 missense probably damaging 1.00
R1831:Micall2 UTSW 5 139716753 missense probably benign 0.09
R1833:Micall2 UTSW 5 139716753 missense probably benign 0.09
R1969:Micall2 UTSW 5 139736130 missense probably damaging 1.00
R2023:Micall2 UTSW 5 139717511 missense possibly damaging 0.51
R2060:Micall2 UTSW 5 139711562 missense probably damaging 0.98
R2330:Micall2 UTSW 5 139717515 missense probably damaging 1.00
R3820:Micall2 UTSW 5 139715856 missense possibly damaging 0.92
R4299:Micall2 UTSW 5 139709471 intron probably benign
R4334:Micall2 UTSW 5 139713350 missense probably damaging 1.00
R4451:Micall2 UTSW 5 139707097 missense probably damaging 1.00
R4769:Micall2 UTSW 5 139706886 missense probably damaging 0.97
R4911:Micall2 UTSW 5 139716825 missense probably damaging 1.00
R4996:Micall2 UTSW 5 139710589 missense probably benign 0.31
R5118:Micall2 UTSW 5 139716447 missense probably damaging 1.00
R5155:Micall2 UTSW 5 139710231 missense probably damaging 1.00
R5475:Micall2 UTSW 5 139716469 missense probably damaging 1.00
R5750:Micall2 UTSW 5 139715701 splice site probably null
R5998:Micall2 UTSW 5 139706911 critical splice acceptor site probably null
R6852:Micall2 UTSW 5 139715793 missense possibly damaging 0.90
R7046:Micall2 UTSW 5 139708944 unclassified probably benign
R7395:Micall2 UTSW 5 139716369 missense possibly damaging 0.78
Z1088:Micall2 UTSW 5 139706894 missense probably damaging 1.00
Z1088:Micall2 UTSW 5 139716295 missense probably benign 0.12
Z1177:Micall2 UTSW 5 139710302 missense unknown
Predicted Primers PCR Primer
(F):5'- CGTCTGGACAAAACCTTTGG -3'
(R):5'- GCATTTGCTGGAAGGGTCAG -3'

Sequencing Primer
(F):5'- ACAAAACCTTTGGCGGTTG -3'
(R):5'- TGGAAGGGTCAGCCACTG -3'
Posted On2017-10-10