Mutagenetix > Incidental Mutation

Incidental Mutation 'R0524:Ripk4'

48808

Institutional Source

Beutler Lab

Gene Symbol

Ripk4

Ensembl Gene

ENSMUSG00000005251

Gene Name

receptor-interacting serine-threonine kinase 4

Synonyms

Ankrd3, DIk, PKK, ANKK2, RIP4

MMRRC Submission

038717-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.244) question?

Stock #

R0524 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

97741933-97763787 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 97755287 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 22 (Y22*)

Ref Sequence

ENSEMBL: ENSMUSP00000109372 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019386] [ENSMUST00000113743]

AlphaFold

Q9ERK0

Predicted Effect

probably null
Transcript: ENSMUST00000019386
AA Change: Y85*

SMART Domains

Protein: ENSMUSP00000019386
Gene: ENSMUSG00000005251
AA Change: Y85*

Domain	Start	End	E-Value	Type
Pfam:Pkinase	22	283	1.8e-47	PFAM
Pfam:Pkinase_Tyr	23	283	6e-45	PFAM
low complexity region	356	396	N/A	INTRINSIC
ANK	439	468	2.58e-3	SMART
ANK	472	501	3.41e-3	SMART
ANK	505	534	7.42e-4	SMART
ANK	538	567	3.57e-6	SMART
ANK	571	601	3.85e-2	SMART
ANK	605	634	3.15e-7	SMART
ANK	638	667	5.16e-3	SMART
ANK	671	700	2.2e-6	SMART
ANK	704	734	1.68e-2	SMART
ANK	736	765	3.46e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000113743
AA Change: Y22*

SMART Domains

Protein: ENSMUSP00000109372
Gene: ENSMUSG00000005251
AA Change: Y22*

Domain	Start	End	E-Value	Type
Pfam:Pkinase	1	220	1e-39	PFAM
Pfam:Pkinase_Tyr	1	220	7.4e-39	PFAM
low complexity region	293	333	N/A	INTRINSIC
ANK	376	405	2.58e-3	SMART
ANK	409	438	3.41e-3	SMART
ANK	442	471	7.42e-4	SMART
ANK	475	504	3.57e-6	SMART
ANK	508	538	3.85e-2	SMART
ANK	542	571	3.15e-7	SMART
ANK	575	604	5.16e-3	SMART
ANK	608	637	2.2e-6	SMART
ANK	641	671	1.68e-2	SMART
ANK	673	702	3.46e-4	SMART

Coding Region Coverage

1x: 99.5%
3x: 98.7%
10x: 96.4%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase that interacts with protein kinase C-delta. The encoded protein can also activate NFkappaB and is required for keratinocyte differentiation. This kinase undergoes autophosphorylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in perinatal lethality and epithelial developmental defects. Homozygous mutant lack oral, anal, and nasal openings and display shorter hindlimbs and tail that are partially fused to the body. The skin is significantly thicker with areas of orthokeratosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd3	CGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGA	1: 180,747,059		probably benign	Het
Adamts16	T	C	13: 70,800,894	E216G	probably benign	Het
Aoc3	C	A	11: 101,337,511	P715T	probably damaging	Het
Bnipl	T	C	3: 95,249,829	D33G	probably benign	Het
Celsr2	T	C	3: 108,401,587	H1701R	probably damaging	Het
Clca3b	T	A	3: 144,825,321	H756L	probably benign	Het
Clca4a	A	G	3: 144,969,393	W159R	probably damaging	Het
Ddx49	A	T	8: 70,296,924	I252N	probably damaging	Het
Duox2	T	C	2: 122,281,836	T1290A	possibly damaging	Het
Fam111a	T	A	19: 12,588,048	I431K	probably damaging	Het
Fam135b	A	T	15: 71,462,284	D1020E	probably benign	Het
Flii	A	G	11: 60,720,061	V514A	probably damaging	Het
Frmpd1	G	A	4: 45,256,902	V157M	probably damaging	Het
Frmpd1	A	G	4: 45,283,774	D865G	probably benign	Het
Gm6970	T	A	19: 47,170,494	K214M	unknown	Het
Gsr	G	A	8: 33,669,180		probably null	Het
Hps3	A	T	3: 20,012,776	V542E	probably damaging	Het
Kcnj5	A	G	9: 32,322,974	I15T	probably benign	Het
Kif2b	T	C	11: 91,575,724	R578G	probably benign	Het
Lamb2	A	G	9: 108,484,372	R676G	possibly damaging	Het
Mrpl40	A	G	16: 18,873,552	F94S	possibly damaging	Het
Myo7b	C	T	18: 32,013,424	V103M	possibly damaging	Het
Nmt2	T	A	2: 3,305,437	W69R	probably benign	Het
Nsd3	C	A	8: 25,700,577	Q1130K	possibly damaging	Het
Olfml1	T	C	7: 107,590,177	S150P	probably damaging	Het
Olfr123	A	T	17: 37,795,605	K54*	probably null	Het
Olfr1471	A	G	19: 13,445,864	N284S	probably damaging	Het
Pask	A	T	1: 93,310,834	W1310R	probably damaging	Het
Pcdh18	T	C	3: 49,755,642	Q408R	probably damaging	Het
Pfkm	A	G	15: 98,131,607	I700V	probably benign	Het
Pias1	A	G	9: 62,952,178	V16A	probably damaging	Het
Pnpla8	C	T	12: 44,283,618	Q318*	probably null	Het
Ppp1cc	C	T	5: 122,172,770	R142*	probably null	Het
Pygl	T	A	12: 70,207,724	N149I	probably damaging	Het
Rapgef6	T	A	11: 54,690,284	S1285T	probably benign	Het
Rdh13	A	C	7: 4,444,297	C10W	probably damaging	Het
Rgr	A	T	14: 37,038,295	C273S	probably benign	Het
Slc34a2	G	A	5: 53,064,873	W302*	probably null	Het
Smarce1	G	A	11: 99,214,062	T263M	probably damaging	Het
Sypl	C	T	12: 32,967,565	P94L	possibly damaging	Het
Tet3	A	G	6: 83,379,942	I878T	probably damaging	Het
Tmem232	A	G	17: 65,485,942	S87P	probably damaging	Het
Tmem260	A	G	14: 48,472,478	T163A	probably benign	Het
Ttn	T	C	2: 76,725,452	Y30403C	probably damaging	Het
Ubash3b	A	T	9: 41,016,608	M468K	probably benign	Het
Ulk4	A	G	9: 121,252,651		probably null	Het
Vmn1r72	A	G	7: 11,669,792	F243S	probably benign	Het
Wrap73	A	G	4: 154,145,307	Y45C	probably damaging	Het
Zfp704	T	C	3: 9,609,364	D119G	unknown	Het
Zfp719	A	G	7: 43,589,253		probably null	Het

Other mutations in Ripk4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01548:Ripk4	APN	16	97751496	nonsense	probably null
IGL01823:Ripk4	APN	16	97755283	missense	possibly damaging	0.89
IGL01921:Ripk4	APN	16	97743365	missense	possibly damaging	0.62
IGL02023:Ripk4	APN	16	97755231	missense	probably damaging	1.00
IGL02201:Ripk4	APN	16	97755177	missense	possibly damaging	0.91
IGL02709:Ripk4	APN	16	97743566	missense	probably damaging	1.00
G1citation:Ripk4	UTSW	16	97746036	missense	probably damaging	1.00
I2288:Ripk4	UTSW	16	97748145	missense	probably benign	0.16
PIT4495001:Ripk4	UTSW	16	97743170	missense	probably damaging	0.99
R0060:Ripk4	UTSW	16	97763518	splice site	probably benign
R0112:Ripk4	UTSW	16	97743561	missense	probably benign	0.00
R0383:Ripk4	UTSW	16	97748112	missense	probably damaging	1.00
R0540:Ripk4	UTSW	16	97744175	missense	probably damaging	1.00
R0967:Ripk4	UTSW	16	97744172	missense	probably damaging	1.00
R1646:Ripk4	UTSW	16	97743897	missense	probably damaging	1.00
R1785:Ripk4	UTSW	16	97750131	missense	probably damaging	1.00
R2058:Ripk4	UTSW	16	97744142	nonsense	probably null
R2134:Ripk4	UTSW	16	97743733	missense	probably damaging	1.00
R2135:Ripk4	UTSW	16	97743733	missense	probably damaging	1.00
R3410:Ripk4	UTSW	16	97743957	missense	probably benign	0.00
R3411:Ripk4	UTSW	16	97743957	missense	probably benign	0.00
R4538:Ripk4	UTSW	16	97743152	nonsense	probably null
R4627:Ripk4	UTSW	16	97744026	missense	probably damaging	0.99
R4665:Ripk4	UTSW	16	97755073	missense	probably damaging	0.98
R4704:Ripk4	UTSW	16	97746004	nonsense	probably null
R4769:Ripk4	UTSW	16	97744062	missense	probably damaging	1.00
R4860:Ripk4	UTSW	16	97751536	missense	probably damaging	0.97
R4860:Ripk4	UTSW	16	97751536	missense	probably damaging	0.97
R5240:Ripk4	UTSW	16	97743767	missense	probably damaging	1.00
R5864:Ripk4	UTSW	16	97763582	missense	probably damaging	0.98
R6027:Ripk4	UTSW	16	97744074	missense	probably damaging	1.00
R6035:Ripk4	UTSW	16	97744187	missense	probably damaging	1.00
R6035:Ripk4	UTSW	16	97744187	missense	probably damaging	1.00
R6291:Ripk4	UTSW	16	97755123	missense	probably damaging	1.00
R6343:Ripk4	UTSW	16	97763526	critical splice donor site	probably benign
R6572:Ripk4	UTSW	16	97745905	nonsense	probably null
R6783:Ripk4	UTSW	16	97748037	missense	probably damaging	1.00
R6822:Ripk4	UTSW	16	97746036	missense	probably damaging	1.00
R7215:Ripk4	UTSW	16	97747323	splice site	probably null
R7251:Ripk4	UTSW	16	97743249	missense	probably benign
R7275:Ripk4	UTSW	16	97743957	missense	probably benign	0.00
R7356:Ripk4	UTSW	16	97743149	missense	probably damaging	0.98
R7621:Ripk4	UTSW	16	97745925	missense	probably damaging	1.00
R8065:Ripk4	UTSW	16	97763537	missense	probably damaging	0.97
R8067:Ripk4	UTSW	16	97763537	missense	probably damaging	0.97
R8191:Ripk4	UTSW	16	97763526	critical splice donor site	probably benign
R8742:Ripk4	UTSW	16	97755072	missense	probably damaging	1.00
R8968:Ripk4	UTSW	16	97746003	missense	probably benign	0.38
R9209:Ripk4	UTSW	16	97750111	missense	possibly damaging	0.74
R9513:Ripk4	UTSW	16	97745898	nonsense	probably null
R9784:Ripk4	UTSW	16	97748106	missense	possibly damaging	0.46
Z1176:Ripk4	UTSW	16	97750102	missense	probably damaging	1.00
Z1177:Ripk4	UTSW	16	97755178	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GCAATGCAGGAAGTTCATGCCCAC -3'
(R):5'- CTTGCCCAACTCTTGATACAGGCTC -3'

Sequencing Primer
(F):5'- GTCTCCATGTACTCCATGACCAA -3'
(R):5'- TTTCCATCCAGACAAGGGATGTG -3'

Posted On

2013-06-12