Incidental Mutation 'R6181:Ankrd26'
ID488085
Institutional Source Beutler Lab
Gene Symbol Ankrd26
Ensembl Gene ENSMUSG00000007827
Gene Nameankyrin repeat domain 26
Synonyms5730521P14Rik
MMRRC Submission 044323-MU
Accession Numbers

Genbank: NM_001081112;MGI: 1917887

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6181 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location118501308-118562226 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118548877 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 369 (H369L)
Ref Sequence ENSEMBL: ENSMUSP00000108449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112830]
Predicted Effect probably benign
Transcript: ENSMUST00000112830
AA Change: H369L

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000108449
Gene: ENSMUSG00000007827
AA Change: H369L

DomainStartEndE-ValueType
ANK 80 109 1.5e-7 SMART
ANK 113 142 3.5e-4 SMART
ANK 146 175 1.9e-6 SMART
ANK 179 208 2.2e-4 SMART
low complexity region 306 316 N/A INTRINSIC
low complexity region 568 580 N/A INTRINSIC
Blast:BRLZ 692 754 4e-10 BLAST
Pfam:CCDC144C 886 1190 2e-142 PFAM
low complexity region 1298 1315 N/A INTRINSIC
low complexity region 1345 1357 N/A INTRINSIC
coiled coil region 1407 1444 N/A INTRINSIC
low complexity region 1473 1486 N/A INTRINSIC
Pfam:DUF3496 1495 1602 1.3e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188022
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing N-terminal ankyrin repeats which function in protein-protein interactions. Mutations in this gene are associated with autosomal dominant thrombocytopenia-2. Pseudogenes of this gene are found on chromosome 7, 10, 13 and 16. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele have enlarged kidneys and hearts, exhibit increased lean body mass and adiposity, develop extreme obesity associated with hyperphagia rather than reduced energy expenditure, and show insulin resistance and gigantism. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik A G 5: 31,488,055 E384G probably damaging Het
Akr1b7 A G 6: 34,415,378 H42R possibly damaging Het
Ano7 T C 1: 93,395,359 S474P probably damaging Het
Aox3 T C 1: 58,158,946 V639A probably benign Het
Arhgef2 T A 3: 88,635,620 V358E probably damaging Het
BC017158 A G 7: 128,297,460 probably null Het
Brpf3 A G 17: 28,810,581 Y505C probably damaging Het
Casd1 A G 6: 4,619,331 T120A probably damaging Het
Clasp1 T G 1: 118,419,817 S32A probably benign Het
Clca2 A T 3: 145,090,708 L246* probably null Het
Clcn7 A G 17: 25,151,728 I353V possibly damaging Het
Cluap1 T A 16: 3,933,744 D322E probably benign Het
Cmtm4 A C 8: 104,356,365 probably null Het
Cntnap2 C T 6: 46,759,808 P723S probably damaging Het
Col6a3 T A 1: 90,816,374 T84S possibly damaging Het
Corin A G 5: 72,372,096 probably null Het
Cubn G A 2: 13,349,876 T1903I probably benign Het
Cyp27b1 A C 10: 127,050,410 D320A probably damaging Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Dennd2a T C 6: 39,485,620 K652R probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock1 T A 7: 135,158,522 M1638K probably damaging Het
Eya1 T C 1: 14,302,872 S8G probably damaging Het
Fam193a T A 5: 34,443,540 probably null Het
Fam208a T A 14: 27,472,278 M1145K probably benign Het
Fbxw11 T A 11: 32,742,575 N515K probably benign Het
Gm11639 T C 11: 104,831,333 S1924P probably benign Het
Gm13083 T A 4: 143,616,258 probably null Het
Gm609 A G 16: 45,417,897 S185P probably benign Het
Gm6408 T C 5: 146,483,772 V154A possibly damaging Het
Guf1 A G 5: 69,561,716 Y235C probably damaging Het
Hnrnpul2 C T 19: 8,823,232 S224L possibly damaging Het
Igkv8-19 T A 6: 70,340,984 D86V probably damaging Het
Iqcf1 A T 9: 106,501,975 D61V probably damaging Het
Lrp5 T C 19: 3,628,427 D476G probably damaging Het
Luzp1 A G 4: 136,543,267 T934A probably benign Het
Mboat7 A T 7: 3,683,885 Y319N probably benign Het
Mdn1 A G 4: 32,715,953 E2045G probably damaging Het
Mfsd14b T C 13: 65,112,584 R12G probably benign Het
Micall2 T A 5: 139,716,751 T246S probably benign Het
Npepps A G 11: 97,242,004 V299A probably damaging Het
Olfr1381 T A 11: 49,552,293 V182D probably damaging Het
P2ry13 A G 3: 59,209,907 V150A probably benign Het
Pdc T C 1: 150,333,270 I168T probably damaging Het
Pde8b C T 13: 95,086,808 E313K probably benign Het
Pgap1 C T 1: 54,512,777 G499R probably benign Het
Ppp1r15b T A 1: 133,132,523 C259* probably null Het
Ptgs1 A G 2: 36,251,119 E526G probably damaging Het
Ptpn21 A G 12: 98,699,999 L271P probably damaging Het
Rbm47 T C 5: 66,026,490 T257A possibly damaging Het
Rfc3 C T 5: 151,647,520 D104N probably damaging Het
Rhobtb3 A G 13: 75,910,689 I330T probably benign Het
Rnf207 T C 4: 152,308,848 T570A probably benign Het
Sbpl T C 17: 23,953,492 H151R probably damaging Het
Sstr3 T C 15: 78,539,461 D362G probably benign Het
St7 T C 6: 17,694,364 probably null Het
Tdrd6 A G 17: 43,628,897 V420A probably damaging Het
Tet2 C A 3: 133,487,759 E305* probably null Het
Tmem209 A T 6: 30,505,971 V68E probably damaging Het
Tmod4 A T 3: 95,127,807 I208F probably damaging Het
Tpo G A 12: 30,131,885 L4F probably benign Het
Urb1 T C 16: 90,779,094 H858R probably benign Het
Utrn A G 10: 12,739,456 W324R probably damaging Het
V1rd19 T A 7: 24,003,215 F35L possibly damaging Het
Vmn1r170 C A 7: 23,606,267 N31K probably damaging Het
Vmn1r192 T A 13: 22,187,282 Y256F probably damaging Het
Vmn2r124 T C 17: 18,073,757 I702T possibly damaging Het
Vmn2r96 G A 17: 18,583,864 A459T probably benign Het
Vwf G T 6: 125,566,146 A132S probably damaging Het
Zfp202 G A 9: 40,207,342 G17E probably damaging Het
Zfp608 A G 18: 54,895,628 S1238P possibly damaging Het
Zfp804a G T 2: 82,257,142 M438I probably damaging Het
Zgrf1 G A 3: 127,587,941 G246S probably damaging Het
Zwint T C 10: 72,656,599 V115A probably benign Het
Other mutations in Ankrd26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Ankrd26 APN 6 118559358 nonsense probably null
IGL01286:Ankrd26 APN 6 118559107 missense probably damaging 1.00
IGL01574:Ankrd26 APN 6 118539698 missense probably damaging 1.00
IGL01727:Ankrd26 APN 6 118511636 missense probably damaging 1.00
IGL01954:Ankrd26 APN 6 118559005 missense possibly damaging 0.62
IGL02200:Ankrd26 APN 6 118559341 missense probably damaging 1.00
IGL02708:Ankrd26 APN 6 118518418 splice site probably benign
IGL02973:Ankrd26 APN 6 118523550 missense probably damaging 0.98
IGL03233:Ankrd26 APN 6 118535146 splice site probably null
ANU74:Ankrd26 UTSW 6 118552775 missense probably benign 0.02
N/A:Ankrd26 UTSW 6 118529574 missense probably benign 0.04
R0078:Ankrd26 UTSW 6 118535069 splice site probably benign
R0083:Ankrd26 UTSW 6 118523254 missense probably benign 0.36
R0165:Ankrd26 UTSW 6 118540484 missense probably benign 0.01
R0344:Ankrd26 UTSW 6 118507637 critical splice donor site probably null
R0828:Ankrd26 UTSW 6 118533473 splice site probably benign
R1532:Ankrd26 UTSW 6 118522958 missense probably damaging 1.00
R1809:Ankrd26 UTSW 6 118525922 splice site probably benign
R1875:Ankrd26 UTSW 6 118540449 critical splice donor site probably null
R1940:Ankrd26 UTSW 6 118511693 missense probably damaging 1.00
R2164:Ankrd26 UTSW 6 118525791 missense probably damaging 1.00
R2202:Ankrd26 UTSW 6 118523882 missense possibly damaging 0.79
R2204:Ankrd26 UTSW 6 118523882 missense possibly damaging 0.79
R2205:Ankrd26 UTSW 6 118523882 missense possibly damaging 0.79
R3107:Ankrd26 UTSW 6 118556243 missense probably benign 0.01
R3419:Ankrd26 UTSW 6 118535107 missense probably damaging 1.00
R3552:Ankrd26 UTSW 6 118507776 missense probably damaging 1.00
R3899:Ankrd26 UTSW 6 118549428 missense probably benign 0.30
R4157:Ankrd26 UTSW 6 118507821 missense probably damaging 1.00
R4194:Ankrd26 UTSW 6 118523678 missense probably benign 0.21
R4230:Ankrd26 UTSW 6 118559388 splice site probably null
R4651:Ankrd26 UTSW 6 118515826 missense probably benign 0.03
R4701:Ankrd26 UTSW 6 118506485 missense possibly damaging 0.65
R4747:Ankrd26 UTSW 6 118527757 missense probably benign 0.01
R4752:Ankrd26 UTSW 6 118540465 missense probably null 1.00
R4834:Ankrd26 UTSW 6 118523718 missense probably benign 0.08
R4835:Ankrd26 UTSW 6 118548850 nonsense probably null
R4849:Ankrd26 UTSW 6 118532296 missense probably benign 0.00
R5149:Ankrd26 UTSW 6 118558996 missense probably benign 0.05
R5389:Ankrd26 UTSW 6 118508575 missense possibly damaging 0.82
R5473:Ankrd26 UTSW 6 118515836 missense probably benign 0.04
R5518:Ankrd26 UTSW 6 118548908 missense probably benign 0.00
R5525:Ankrd26 UTSW 6 118527731 missense probably benign 0.00
R5608:Ankrd26 UTSW 6 118511622 missense probably damaging 1.00
R5639:Ankrd26 UTSW 6 118539724 missense possibly damaging 0.72
R5704:Ankrd26 UTSW 6 118523882 missense probably damaging 0.96
R5927:Ankrd26 UTSW 6 118507636 critical splice donor site probably null
R5943:Ankrd26 UTSW 6 118505746 missense probably damaging 1.00
R5976:Ankrd26 UTSW 6 118517894 critical splice donor site probably null
R6478:Ankrd26 UTSW 6 118511638 missense probably benign 0.28
R6667:Ankrd26 UTSW 6 118507788 missense probably benign 0.02
R6865:Ankrd26 UTSW 6 118523481 missense possibly damaging 0.90
R7224:Ankrd26 UTSW 6 118539727 missense probably benign 0.07
R7287:Ankrd26 UTSW 6 118549637 critical splice donor site probably null
R7301:Ankrd26 UTSW 6 118511663 missense possibly damaging 0.62
R7348:Ankrd26 UTSW 6 118508564 missense probably damaging 1.00
R7414:Ankrd26 UTSW 6 118508780 missense possibly damaging 0.60
R7789:Ankrd26 UTSW 6 118527798 missense probably damaging 0.98
R7789:Ankrd26 UTSW 6 118527799 missense possibly damaging 0.82
X0028:Ankrd26 UTSW 6 118507761 missense probably damaging 1.00
Z1177:Ankrd26 UTSW 6 118523532 missense possibly damaging 0.77
Z1177:Ankrd26 UTSW 6 118523595 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTTCACACGGAATTGGTATAGC -3'
(R):5'- GGCATGGACCTTTCGCTTAC -3'

Sequencing Primer
(F):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
(R):5'- GCTTACTCACTGCAGCCTG -3'
Posted On2017-10-10