Incidental Mutation 'R6181:Vwf'
ID488086
Institutional Source Beutler Lab
Gene Symbol Vwf
Ensembl Gene ENSMUSG00000001930
Gene NameVon Willebrand factor
Synonyms6820430P06Rik, B130011O06Rik
MMRRC Submission 044323-MU
Accession Numbers

Genbank: NM_011708; MGI: 98941

Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R6181 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location125546774-125686679 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 125566146 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 132 (A132S)
Ref Sequence ENSEMBL: ENSMUSP00000098502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100941] [ENSMUST00000112253] [ENSMUST00000112254]
Predicted Effect probably damaging
Transcript: ENSMUST00000100941
AA Change: A132S

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098502
Gene: ENSMUSG00000001930
AA Change: A132S

DomainStartEndE-ValueType
VWD 38 196 3.43e-35 SMART
C8 236 310 1.11e-21 SMART
Pfam:TIL 313 366 2.8e-15 PFAM
Blast:VWC 368 404 6e-18 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000112253
AA Change: A117S

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107872
Gene: ENSMUSG00000001930
AA Change: A117S

DomainStartEndE-ValueType
VWD 23 181 3.43e-35 SMART
C8 221 295 1.11e-21 SMART
Pfam:TIL 298 351 2.7e-15 PFAM
Blast:VWC 353 389 6e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112254
AA Change: A114S

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107873
Gene: ENSMUSG00000001930
AA Change: A114S

DomainStartEndE-ValueType
VWD 23 181 3.43e-35 SMART
C8 221 295 1.11e-21 SMART
Pfam:TIL 298 351 6.9e-15 PFAM
VWC 353 413 8.71e-1 SMART
VWD 380 543 2.93e-52 SMART
C8 580 652 3.82e-25 SMART
Pfam:TIL 655 710 4.1e-14 PFAM
EGF_like 790 825 4.37e1 SMART
VWC 832 901 3.29e-3 SMART
VWD 859 1015 5.15e-39 SMART
C8 1056 1130 1.01e-33 SMART
Pfam:TIL 1144 1199 1.3e-9 PFAM
VWA 1278 1461 1.81e-20 SMART
low complexity region 1464 1477 N/A INTRINSIC
VWA 1499 1672 8.43e-39 SMART
VWA 1692 1875 2.83e-31 SMART
VWC 1882 1949 2.99e0 SMART
VWD 1941 2104 5.03e-42 SMART
C8 2135 2203 1.29e-13 SMART
Pfam:TIL 2206 2257 8.3e-8 PFAM
VWC 2260 2328 3.16e-16 SMART
low complexity region 2417 2428 N/A INTRINSIC
VWC 2434 2497 2.61e-17 SMART
VWC 2513 2577 3.37e0 SMART
VWC 2585 2647 2.55e-11 SMART
CT 2730 2815 1.37e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126709
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150548
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mutants exhibit hemostatic and thrombotic defects similar to human von Willebrand disease. Mutants have prolonged bleeding time, newborns occasionally show fatal intra-abdominal bleeding and some adults have detectable fecal occult blood. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted, knock-out(1) Gene trapped(32)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik A G 5: 31,488,055 E384G probably damaging Het
Akr1b7 A G 6: 34,415,378 H42R possibly damaging Het
Ankrd26 T A 6: 118,548,877 H369L probably benign Het
Ano7 T C 1: 93,395,359 S474P probably damaging Het
Aox3 T C 1: 58,158,946 V639A probably benign Het
Arhgef2 T A 3: 88,635,620 V358E probably damaging Het
BC017158 A G 7: 128,297,460 probably null Het
Brpf3 A G 17: 28,810,581 Y505C probably damaging Het
Casd1 A G 6: 4,619,331 T120A probably damaging Het
Clasp1 T G 1: 118,419,817 S32A probably benign Het
Clca2 A T 3: 145,090,708 L246* probably null Het
Clcn7 A G 17: 25,151,728 I353V possibly damaging Het
Cluap1 T A 16: 3,933,744 D322E probably benign Het
Cmtm4 A C 8: 104,356,365 probably null Het
Cntnap2 C T 6: 46,759,808 P723S probably damaging Het
Col6a3 T A 1: 90,816,374 T84S possibly damaging Het
Corin A G 5: 72,372,096 probably null Het
Cubn G A 2: 13,349,876 T1903I probably benign Het
Cyp27b1 A C 10: 127,050,410 D320A probably damaging Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Dennd2a T C 6: 39,485,620 K652R probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock1 T A 7: 135,158,522 M1638K probably damaging Het
Eya1 T C 1: 14,302,872 S8G probably damaging Het
Fam193a T A 5: 34,443,540 probably null Het
Fam208a T A 14: 27,472,278 M1145K probably benign Het
Fbxw11 T A 11: 32,742,575 N515K probably benign Het
Gm11639 T C 11: 104,831,333 S1924P probably benign Het
Gm13083 T A 4: 143,616,258 probably null Het
Gm609 A G 16: 45,417,897 S185P probably benign Het
Gm6408 T C 5: 146,483,772 V154A possibly damaging Het
Guf1 A G 5: 69,561,716 Y235C probably damaging Het
Hnrnpul2 C T 19: 8,823,232 S224L possibly damaging Het
Igkv8-19 T A 6: 70,340,984 D86V probably damaging Het
Iqcf1 A T 9: 106,501,975 D61V probably damaging Het
Lrp5 T C 19: 3,628,427 D476G probably damaging Het
Luzp1 A G 4: 136,543,267 T934A probably benign Het
Mboat7 A T 7: 3,683,885 Y319N probably benign Het
Mdn1 A G 4: 32,715,953 E2045G probably damaging Het
Mfsd14b T C 13: 65,112,584 R12G probably benign Het
Micall2 T A 5: 139,716,751 T246S probably benign Het
Npepps A G 11: 97,242,004 V299A probably damaging Het
Olfr1381 T A 11: 49,552,293 V182D probably damaging Het
P2ry13 A G 3: 59,209,907 V150A probably benign Het
Pdc T C 1: 150,333,270 I168T probably damaging Het
Pde8b C T 13: 95,086,808 E313K probably benign Het
Pgap1 C T 1: 54,512,777 G499R probably benign Het
Ppp1r15b T A 1: 133,132,523 C259* probably null Het
Ptgs1 A G 2: 36,251,119 E526G probably damaging Het
Ptpn21 A G 12: 98,699,999 L271P probably damaging Het
Rbm47 T C 5: 66,026,490 T257A possibly damaging Het
Rfc3 C T 5: 151,647,520 D104N probably damaging Het
Rhobtb3 A G 13: 75,910,689 I330T probably benign Het
Rnf207 T C 4: 152,308,848 T570A probably benign Het
Sbpl T C 17: 23,953,492 H151R probably damaging Het
Sstr3 T C 15: 78,539,461 D362G probably benign Het
St7 T C 6: 17,694,364 probably null Het
Tdrd6 A G 17: 43,628,897 V420A probably damaging Het
Tet2 C A 3: 133,487,759 E305* probably null Het
Tmem209 A T 6: 30,505,971 V68E probably damaging Het
Tmod4 A T 3: 95,127,807 I208F probably damaging Het
Tpo G A 12: 30,131,885 L4F probably benign Het
Urb1 T C 16: 90,779,094 H858R probably benign Het
Utrn A G 10: 12,739,456 W324R probably damaging Het
V1rd19 T A 7: 24,003,215 F35L possibly damaging Het
Vmn1r170 C A 7: 23,606,267 N31K probably damaging Het
Vmn1r192 T A 13: 22,187,282 Y256F probably damaging Het
Vmn2r124 T C 17: 18,073,757 I702T possibly damaging Het
Vmn2r96 G A 17: 18,583,864 A459T probably benign Het
Zfp202 G A 9: 40,207,342 G17E probably damaging Het
Zfp608 A G 18: 54,895,628 S1238P possibly damaging Het
Zfp804a G T 2: 82,257,142 M438I probably damaging Het
Zgrf1 G A 3: 127,587,941 G246S probably damaging Het
Zwint T C 10: 72,656,599 V115A probably benign Het
Other mutations in Vwf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Vwf APN 6 125658872 missense unknown
IGL00561:Vwf APN 6 125642721 missense possibly damaging 0.88
IGL01104:Vwf APN 6 125683556 missense probably damaging 1.00
IGL01404:Vwf APN 6 125677970 missense probably damaging 1.00
IGL01539:Vwf APN 6 125590262 missense possibly damaging 0.85
IGL01550:Vwf APN 6 125679289 missense probably benign 0.00
IGL01563:Vwf APN 6 125591165 missense probably damaging 1.00
IGL01637:Vwf APN 6 125645736 missense probably damaging 1.00
IGL01720:Vwf APN 6 125642835 missense possibly damaging 0.69
IGL01834:Vwf APN 6 125590170 splice site probably benign
IGL02103:Vwf APN 6 125646355 missense probably damaging 1.00
IGL02120:Vwf APN 6 125616034 missense probably benign 0.26
IGL02174:Vwf APN 6 125555395 missense probably damaging 1.00
IGL02203:Vwf APN 6 125642406 missense probably damaging 1.00
IGL02420:Vwf APN 6 125677916 missense probably benign 0.00
IGL02723:Vwf APN 6 125642930 missense possibly damaging 0.85
IGL02818:Vwf APN 6 125663548 missense probably benign
IGL02931:Vwf APN 6 125615968 missense possibly damaging 0.68
IGL03015:Vwf APN 6 125684138 splice site probably benign
IGL03038:Vwf APN 6 125604157 missense possibly damaging 0.92
IGL03060:Vwf APN 6 125663560 missense probably damaging 1.00
IGL03114:Vwf APN 6 125599363 nonsense probably null
IGL03266:Vwf APN 6 125678077 splice site probably benign
gingerman UTSW 6 125662963 critical splice acceptor site probably null
R0605_vwf_644 UTSW 6 125685837 missense probably benign 0.02
R1575_Vwf_091 UTSW 6 125663571 nonsense probably null
R1628_Vwf_608 UTSW 6 125647738 unclassified probably benign
R1669_Vwf_448 UTSW 6 125647906 missense possibly damaging 0.92
R1833_Vwf_948 UTSW 6 125642037 missense probably benign 0.14
R2130_vwf_946 UTSW 6 125657057 missense probably damaging 1.00
R6360_Vwf_065 UTSW 6 125683526 missense probably benign 0.13
R7900_Vwf_938 UTSW 6 125628476 critical splice donor site probably null
Russiahouse UTSW 6 125639341 nonsense probably null
B5639:Vwf UTSW 6 125642984 missense probably damaging 1.00
R0025:Vwf UTSW 6 125682812 missense probably benign 0.05
R0025:Vwf UTSW 6 125682812 missense probably benign 0.05
R0087:Vwf UTSW 6 125645954 missense probably benign 0.03
R0194:Vwf UTSW 6 125643297 missense probably benign
R0206:Vwf UTSW 6 125637456 missense probably damaging 1.00
R0233:Vwf UTSW 6 125686510 missense possibly damaging 0.91
R0233:Vwf UTSW 6 125686510 missense possibly damaging 0.91
R0390:Vwf UTSW 6 125626361 nonsense probably null
R0427:Vwf UTSW 6 125673939 missense probably benign
R0437:Vwf UTSW 6 125566318 missense probably damaging 1.00
R0470:Vwf UTSW 6 125628428 missense possibly damaging 0.70
R0499:Vwf UTSW 6 125638114 missense probably benign 0.10
R0554:Vwf UTSW 6 125642781 missense probably benign 0.13
R0605:Vwf UTSW 6 125685837 missense probably benign 0.02
R0711:Vwf UTSW 6 125626271 missense probably benign 0.01
R0723:Vwf UTSW 6 125566262 missense probably benign 0.01
R0973:Vwf UTSW 6 125643006 missense probably damaging 1.00
R1054:Vwf UTSW 6 125590227 missense probably damaging 1.00
R1115:Vwf UTSW 6 125655065 missense unknown
R1156:Vwf UTSW 6 125637488 missense probably damaging 1.00
R1191:Vwf UTSW 6 125599252 missense probably damaging 1.00
R1240:Vwf UTSW 6 125603308 splice site probably null
R1398:Vwf UTSW 6 125603457 missense probably benign 0.02
R1435:Vwf UTSW 6 125642249 nonsense probably null
R1528:Vwf UTSW 6 125608291 missense possibly damaging 0.69
R1575:Vwf UTSW 6 125655251 missense unknown
R1575:Vwf UTSW 6 125663571 nonsense probably null
R1628:Vwf UTSW 6 125647738 unclassified probably benign
R1669:Vwf UTSW 6 125647906 missense possibly damaging 0.92
R1699:Vwf UTSW 6 125643069 missense probably damaging 1.00
R1699:Vwf UTSW 6 125685900 missense possibly damaging 0.74
R1725:Vwf UTSW 6 125646282 missense probably benign 0.05
R1742:Vwf UTSW 6 125667550 missense probably benign 0.02
R1809:Vwf UTSW 6 125590175 splice site probably benign
R1833:Vwf UTSW 6 125642037 missense probably benign 0.14
R1866:Vwf UTSW 6 125667529 missense possibly damaging 0.62
R1870:Vwf UTSW 6 125642939 missense probably damaging 1.00
R1874:Vwf UTSW 6 125628372 missense probably benign 0.00
R1941:Vwf UTSW 6 125639279 missense possibly damaging 0.64
R2061:Vwf UTSW 6 125591188 missense probably damaging 0.98
R2103:Vwf UTSW 6 125646330 missense probably benign 0.31
R2104:Vwf UTSW 6 125646330 missense probably benign 0.31
R2130:Vwf UTSW 6 125657057 missense probably damaging 1.00
R2159:Vwf UTSW 6 125626341 missense probably damaging 0.99
R2178:Vwf UTSW 6 125642132 missense possibly damaging 0.90
R2656:Vwf UTSW 6 125555361 missense probably benign 0.00
R2913:Vwf UTSW 6 125685846 missense probably benign 0.08
R2917:Vwf UTSW 6 125608143 missense probably benign 0.07
R3726:Vwf UTSW 6 125677948 utr 3 prime probably benign
R3735:Vwf UTSW 6 125588613 missense probably damaging 1.00
R3774:Vwf UTSW 6 125649099 splice site probably null
R3934:Vwf UTSW 6 125555499 missense probably damaging 1.00
R4291:Vwf UTSW 6 125642322 missense probably damaging 1.00
R4384:Vwf UTSW 6 125655116 missense unknown
R4743:Vwf UTSW 6 125684091 critical splice acceptor site probably null
R4760:Vwf UTSW 6 125570604 missense probably damaging 1.00
R4776:Vwf UTSW 6 125566305 missense possibly damaging 0.53
R4791:Vwf UTSW 6 125643363 missense
R4871:Vwf UTSW 6 125686462 missense probably benign 0.25
R4894:Vwf UTSW 6 125645934 nonsense probably null
R4963:Vwf UTSW 6 125667483 nonsense probably null
R5010:Vwf UTSW 6 125566257 missense probably benign 0.15
R5289:Vwf UTSW 6 125667510 utr 3 prime probably benign
R5512:Vwf UTSW 6 125673887 utr 3 prime probably benign
R5523:Vwf UTSW 6 125643042 missense
R5642:Vwf UTSW 6 125603418 missense
R5860:Vwf UTSW 6 125643090 missense
R5860:Vwf UTSW 6 125679265 utr 3 prime probably benign
R5896:Vwf UTSW 6 125678762 critical splice acceptor site probably null
R5926:Vwf UTSW 6 125604174 missense probably damaging 1.00
R5976:Vwf UTSW 6 125603463 missense
R6053:Vwf UTSW 6 125600665 missense probably benign 0.21
R6151:Vwf UTSW 6 125657065 missense unknown
R6179:Vwf UTSW 6 125649289 missense unknown
R6234:Vwf UTSW 6 125657165 missense unknown
R6360:Vwf UTSW 6 125683526 missense probably benign 0.13
R6412:Vwf UTSW 6 125679316 missense probably benign 0.00
R6464:Vwf UTSW 6 125639400 critical splice donor site probably null
R6522:Vwf UTSW 6 125662963 critical splice acceptor site probably null
R6766:Vwf UTSW 6 125639376 missense unknown
R6856:Vwf UTSW 6 125642150 nonsense probably null
R6877:Vwf UTSW 6 125657201 missense possibly damaging 0.48
R6896:Vwf UTSW 6 125566194 missense probably damaging 1.00
R7113:Vwf UTSW 6 125655044 missense
R7287:Vwf UTSW 6 125637467 missense
R7359:Vwf UTSW 6 125566257 missense
R7509:Vwf UTSW 6 125642169 missense
R7519:Vwf UTSW 6 125667543 missense
R7545:Vwf UTSW 6 125614097 missense
R7549:Vwf UTSW 6 125626267 missense
R7593:Vwf UTSW 6 125647768 missense
R7635:Vwf UTSW 6 125682734 missense
R7793:Vwf UTSW 6 125686520 missense
R7802:Vwf UTSW 6 125666677 missense
R7824:Vwf UTSW 6 125658815 missense
R7849:Vwf UTSW 6 125656803 missense
R7900:Vwf UTSW 6 125628476 critical splice donor site probably null
R7919:Vwf UTSW 6 125647859 missense
R7966:Vwf UTSW 6 125639341 nonsense probably null
R8101:Vwf UTSW 6 125570559 nonsense probably null
R8162:Vwf UTSW 6 125645836 splice site probably null
R8345:Vwf UTSW 6 125679302 missense
R8853:Vwf UTSW 6 125657264 missense
X0021:Vwf UTSW 6 125646331 missense probably damaging 1.00
X0065:Vwf UTSW 6 125603433 missense probably null 0.05
Z1176:Vwf UTSW 6 125591231 missense
Z1176:Vwf UTSW 6 125603308 splice site probably null
Predicted Primers PCR Primer
(F):5'- CAAAGGACCCTGGAGTCTTTCTC -3'
(R):5'- CCGCGAAGATGTTAAAATCACC -3'

Sequencing Primer
(F):5'- TTTAAGCGTAGAAACTGGGTCCCC -3'
(R):5'- GAAGATGTTAAAATCACCGCACAG -3'
Posted On2017-10-10