Incidental Mutation 'R6184:Rgsl1'
ID488123
Institutional Source Beutler Lab
Gene Symbol Rgsl1
Ensembl Gene ENSMUSG00000042641
Gene Nameregulator of G-protein signaling like 1
SynonymsRgsl2, 4930415K13Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6184 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location153779381-153844142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 153827448 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 187 (M187I)
Ref Sequence ENSEMBL: ENSMUSP00000139340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124558] [ENSMUST00000185164]
Predicted Effect probably benign
Transcript: ENSMUST00000124558
AA Change: M152I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000135642
Gene: ENSMUSG00000042641
AA Change: M152I

DomainStartEndE-ValueType
low complexity region 122 136 N/A INTRINSIC
low complexity region 242 254 N/A INTRINSIC
low complexity region 316 325 N/A INTRINSIC
Pfam:RGS 644 754 7.1e-12 PFAM
transmembrane domain 956 973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184095
Predicted Effect probably benign
Transcript: ENSMUST00000185164
AA Change: M187I

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000139340
Gene: ENSMUSG00000042641
AA Change: M187I

DomainStartEndE-ValueType
low complexity region 157 171 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
low complexity region 351 360 N/A INTRINSIC
Pfam:RGS 679 789 4.1e-11 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik A G 12: 17,007,178 F106S probably benign Het
Adgrv1 A T 13: 81,433,838 F4696I probably benign Het
Ank2 T C 3: 126,962,398 I1073V probably damaging Het
BC048403 T C 10: 121,750,905 L375P probably damaging Het
Card11 A T 5: 140,898,278 D415E probably damaging Het
Clec16a G A 16: 10,572,928 probably null Het
Coro2a T C 4: 46,540,504 T472A probably benign Het
D130043K22Rik T A 13: 24,885,591 F878I probably damaging Het
D5Ertd579e G T 5: 36,629,783 D80E probably damaging Het
Ddrgk1 A T 2: 130,664,561 V2E possibly damaging Het
Disp1 T C 1: 183,086,332 H1508R probably benign Het
Dmtf1 T C 5: 9,126,656 N344S probably benign Het
Eml5 A G 12: 98,863,129 V503A possibly damaging Het
Fat1 A G 8: 44,953,392 H1060R probably benign Het
Fbxw8 C T 5: 118,113,749 R233Q probably damaging Het
Fer1l4 T C 2: 156,048,291 K238R probably damaging Het
Flg T A 3: 93,280,050 S270T probably benign Het
Gm10801 TC TCGCC 2: 98,663,806 probably benign Het
Gm3604 A T 13: 62,371,845 V32D probably damaging Het
Gnl2 T G 4: 125,054,229 probably null Het
Gpr162 A G 6: 124,861,241 S149P probably damaging Het
Il2ra T A 2: 11,647,979 probably benign Het
Kmt5b T A 19: 3,804,499 M254K probably damaging Het
Lrriq3 T C 3: 155,129,402 I258T probably benign Het
Mbnl1 T C 3: 60,615,744 L328S probably damaging Het
Mboat2 A G 12: 24,951,431 D277G possibly damaging Het
Mug2 A G 6: 122,037,046 I364V probably benign Het
Myh7 G A 14: 54,988,858 R442C probably damaging Het
Nin A G 12: 70,043,737 L968P probably damaging Het
Olfr1137 A T 2: 87,711,844 Y21N probably benign Het
Olfr355 T C 2: 36,927,392 T241A probably damaging Het
Olfr968 T G 9: 39,772,620 Y60S probably damaging Het
Per1 C T 11: 69,102,904 P403S probably damaging Het
Ppip5k2 T C 1: 97,734,005 I723V possibly damaging Het
Ptprg A G 14: 12,153,943 T555A probably benign Het
Sec31a A G 5: 100,369,594 probably null Het
Sptbn5 C T 2: 120,059,417 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Het
Stx1b G A 7: 127,807,905 T206I possibly damaging Het
Tsc22d4 T A 5: 137,759,089 M35K probably damaging Het
Zc2hc1c A G 12: 85,296,444 K452E probably damaging Het
Zfp386 A G 12: 116,060,513 N582S possibly damaging Het
Zfp457 A G 13: 67,292,912 V437A possibly damaging Het
Zfp599 T C 9: 22,249,651 Y406C probably benign Het
Zfyve26 G A 12: 79,268,727 S1325F probably damaging Het
Other mutations in Rgsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01372:Rgsl1 APN 1 153826141 missense probably damaging 1.00
IGL02253:Rgsl1 APN 1 153793767 missense probably damaging 1.00
IGL02345:Rgsl1 APN 1 153804009 splice site probably null
IGL02409:Rgsl1 APN 1 153826243 missense possibly damaging 0.53
IGL02587:Rgsl1 APN 1 153799938 missense probably damaging 1.00
IGL02652:Rgsl1 APN 1 153825490 missense probably damaging 1.00
IGL02797:Rgsl1 APN 1 153807708 missense probably damaging 1.00
IGL03032:Rgsl1 APN 1 153826202 missense possibly damaging 0.53
IGL03082:Rgsl1 APN 1 153799947 missense possibly damaging 0.86
IGL03123:Rgsl1 APN 1 153825941 missense probably damaging 1.00
IGL03213:Rgsl1 APN 1 153825841 missense probably benign 0.12
IGL03410:Rgsl1 APN 1 153793755 missense probably null 0.82
IGL03050:Rgsl1 UTSW 1 153825676 missense possibly damaging 0.60
PIT4519001:Rgsl1 UTSW 1 153825970 missense possibly damaging 0.96
R0149:Rgsl1 UTSW 1 153793764 missense probably damaging 1.00
R0536:Rgsl1 UTSW 1 153826181 missense probably damaging 1.00
R0633:Rgsl1 UTSW 1 153844107 missense possibly damaging 0.72
R0726:Rgsl1 UTSW 1 153802328 missense probably damaging 1.00
R0839:Rgsl1 UTSW 1 153802234 critical splice donor site probably null
R1240:Rgsl1 UTSW 1 153785191 missense probably benign 0.18
R1355:Rgsl1 UTSW 1 153807761 start codon destroyed probably null 0.23
R1491:Rgsl1 UTSW 1 153825926 missense possibly damaging 0.93
R1688:Rgsl1 UTSW 1 153804676 missense probably damaging 0.98
R1694:Rgsl1 UTSW 1 153804676 missense probably damaging 0.98
R1842:Rgsl1 UTSW 1 153799797 missense probably damaging 1.00
R2008:Rgsl1 UTSW 1 153825905 missense possibly damaging 0.53
R2114:Rgsl1 UTSW 1 153817549 missense probably benign
R2116:Rgsl1 UTSW 1 153817549 missense probably benign
R2176:Rgsl1 UTSW 1 153825268 splice site probably benign
R2229:Rgsl1 UTSW 1 153822358 missense possibly damaging 0.72
R2895:Rgsl1 UTSW 1 153827548 missense probably damaging 1.00
R3923:Rgsl1 UTSW 1 153804130 critical splice acceptor site probably null
R4001:Rgsl1 UTSW 1 153817584 missense probably damaging 1.00
R4434:Rgsl1 UTSW 1 153802341 missense possibly damaging 0.52
R4489:Rgsl1 UTSW 1 153827536 missense probably benign 0.27
R4649:Rgsl1 UTSW 1 153817582 missense probably benign 0.01
R4925:Rgsl1 UTSW 1 153812277 missense probably benign 0.01
R4928:Rgsl1 UTSW 1 153793768 missense probably damaging 1.00
R5045:Rgsl1 UTSW 1 153821522 nonsense probably null
R5304:Rgsl1 UTSW 1 153827492 missense probably damaging 0.97
R5331:Rgsl1 UTSW 1 153802292 missense probably benign 0.02
R5373:Rgsl1 UTSW 1 153790307 missense probably benign 0.33
R5374:Rgsl1 UTSW 1 153790307 missense probably benign 0.33
R5566:Rgsl1 UTSW 1 153793774 missense probably damaging 1.00
R5649:Rgsl1 UTSW 1 153825893 missense possibly damaging 0.93
R6062:Rgsl1 UTSW 1 153799872 missense possibly damaging 0.72
R6142:Rgsl1 UTSW 1 153812238 missense probably benign 0.01
R6158:Rgsl1 UTSW 1 153804021 missense possibly damaging 0.72
R6273:Rgsl1 UTSW 1 153827465 missense possibly damaging 0.96
R6384:Rgsl1 UTSW 1 153827545 missense possibly damaging 0.86
R6419:Rgsl1 UTSW 1 153822371 missense probably damaging 0.98
R6568:Rgsl1 UTSW 1 153821546 missense possibly damaging 0.72
R6660:Rgsl1 UTSW 1 153825766 missense possibly damaging 0.70
R6745:Rgsl1 UTSW 1 153822317 missense probably benign 0.18
R6892:Rgsl1 UTSW 1 153821499 nonsense probably null
R6974:Rgsl1 UTSW 1 153799822 missense probably damaging 1.00
R7172:Rgsl1 UTSW 1 153826220 missense possibly damaging 0.72
R7200:Rgsl1 UTSW 1 153785199 missense probably benign 0.33
R7275:Rgsl1 UTSW 1 153804130 critical splice acceptor site probably null
R7313:Rgsl1 UTSW 1 153807876 critical splice acceptor site probably null
R7341:Rgsl1 UTSW 1 153793845 missense probably benign 0.01
R7448:Rgsl1 UTSW 1 153844101 critical splice donor site probably null
R7662:Rgsl1 UTSW 1 153825479 missense probably benign
R7703:Rgsl1 UTSW 1 153793864 missense possibly damaging 0.73
R7846:Rgsl1 UTSW 1 153826037 missense possibly damaging 0.53
X0020:Rgsl1 UTSW 1 153825385 missense probably benign 0.33
X0065:Rgsl1 UTSW 1 153804033 missense possibly damaging 0.84
Z1177:Rgsl1 UTSW 1 153817610 missense possibly damaging 0.70
Z1177:Rgsl1 UTSW 1 153825988 missense not run
Predicted Primers PCR Primer
(F):5'- ATGGCTGGTGTCCTTCAATC -3'
(R):5'- ATATCATCCAAAGGGGCGAG -3'

Sequencing Primer
(F):5'- GGCTGGTGTCCTTCAATCTTTCTC -3'
(R):5'- ACGAGTGTGCAGCTCTCCATC -3'
Posted On2017-10-10