Incidental Mutation 'R0524:Fam111a'
ID48813
Institutional Source Beutler Lab
Gene Symbol Fam111a
Ensembl Gene ENSMUSG00000024691
Gene Namefamily with sequence similarity 111, member A
Synonyms
MMRRC Submission 038717-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R0524 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location12545740-12589768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12588048 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 431 (I431K)
Ref Sequence ENSEMBL: ENSMUSP00000119518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025595] [ENSMUST00000144662] [ENSMUST00000151307]
Predicted Effect probably damaging
Transcript: ENSMUST00000025595
AA Change: I431K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025595
Gene: ENSMUSG00000024691
AA Change: I431K

DomainStartEndE-ValueType
low complexity region 311 320 N/A INTRINSIC
Pfam:Trypsin 353 580 2.7e-7 PFAM
Pfam:Trypsin_2 368 557 6.4e-15 PFAM
Pfam:Peptidase_S7 491 574 6.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139270
Predicted Effect probably damaging
Transcript: ENSMUST00000144662
AA Change: I431K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119518
Gene: ENSMUSG00000024691
AA Change: I431K

DomainStartEndE-ValueType
low complexity region 311 320 N/A INTRINSIC
Pfam:Trypsin 353 580 2.7e-7 PFAM
Pfam:Trypsin_2 355 557 1.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151307
AA Change: I387K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123598
Gene: ENSMUSG00000024691
AA Change: I387K

DomainStartEndE-ValueType
low complexity region 267 276 N/A INTRINSIC
Pfam:Trypsin 309 536 6.6e-7 PFAM
Pfam:Trypsin_2 324 513 5.6e-15 PFAM
Pfam:Peptidase_S7 447 530 8.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224046
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is cell-cycle regulated, and has nuclear localization. The C-terminal half of the protein shares homology with trypsin-like peptidases and it contains a PCNA-interacting peptide (PIP) box, that is necessary for its co-localization with proliferating cell nuclear antigen (PCNA). Reduced expression of this gene resulted in DNA replication defects, consistent with the demonstrated role for this gene in Simian Virus 40 (SV40) viral replication. Mutations in this gene have been associated with Kenny-Caffey syndrome (KCS) type 2 and the more severe osteocraniostenosis (OCS, also known as Gracile Bone Dysplasia), both characterized by short stature, hypoparathyroidism, bone development abnormalities, and hypocalcemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,747,059 probably benign Het
Adamts16 T C 13: 70,800,894 E216G probably benign Het
Aoc3 C A 11: 101,337,511 P715T probably damaging Het
Bnipl T C 3: 95,249,829 D33G probably benign Het
Celsr2 T C 3: 108,401,587 H1701R probably damaging Het
Clca3b T A 3: 144,825,321 H756L probably benign Het
Clca4a A G 3: 144,969,393 W159R probably damaging Het
Ddx49 A T 8: 70,296,924 I252N probably damaging Het
Duox2 T C 2: 122,281,836 T1290A possibly damaging Het
Fam135b A T 15: 71,462,284 D1020E probably benign Het
Flii A G 11: 60,720,061 V514A probably damaging Het
Frmpd1 G A 4: 45,256,902 V157M probably damaging Het
Frmpd1 A G 4: 45,283,774 D865G probably benign Het
Gm6970 T A 19: 47,170,494 K214M unknown Het
Gsr G A 8: 33,669,180 probably null Het
Hps3 A T 3: 20,012,776 V542E probably damaging Het
Kcnj5 A G 9: 32,322,974 I15T probably benign Het
Kif2b T C 11: 91,575,724 R578G probably benign Het
Lamb2 A G 9: 108,484,372 R676G possibly damaging Het
Mrpl40 A G 16: 18,873,552 F94S possibly damaging Het
Myo7b C T 18: 32,013,424 V103M possibly damaging Het
Nmt2 T A 2: 3,305,437 W69R probably benign Het
Nsd3 C A 8: 25,700,577 Q1130K possibly damaging Het
Olfml1 T C 7: 107,590,177 S150P probably damaging Het
Olfr123 A T 17: 37,795,605 K54* probably null Het
Olfr1471 A G 19: 13,445,864 N284S probably damaging Het
Pask A T 1: 93,310,834 W1310R probably damaging Het
Pcdh18 T C 3: 49,755,642 Q408R probably damaging Het
Pfkm A G 15: 98,131,607 I700V probably benign Het
Pias1 A G 9: 62,952,178 V16A probably damaging Het
Pnpla8 C T 12: 44,283,618 Q318* probably null Het
Ppp1cc C T 5: 122,172,770 R142* probably null Het
Pygl T A 12: 70,207,724 N149I probably damaging Het
Rapgef6 T A 11: 54,690,284 S1285T probably benign Het
Rdh13 A C 7: 4,444,297 C10W probably damaging Het
Rgr A T 14: 37,038,295 C273S probably benign Het
Ripk4 G T 16: 97,755,287 Y22* probably null Het
Slc34a2 G A 5: 53,064,873 W302* probably null Het
Smarce1 G A 11: 99,214,062 T263M probably damaging Het
Sypl C T 12: 32,967,565 P94L possibly damaging Het
Tet3 A G 6: 83,379,942 I878T probably damaging Het
Tmem232 A G 17: 65,485,942 S87P probably damaging Het
Tmem260 A G 14: 48,472,478 T163A probably benign Het
Ttn T C 2: 76,725,452 Y30403C probably damaging Het
Ubash3b A T 9: 41,016,608 M468K probably benign Het
Ulk4 A G 9: 121,252,651 probably null Het
Vmn1r72 A G 7: 11,669,792 F243S probably benign Het
Wrap73 A G 4: 154,145,307 Y45C probably damaging Het
Zfp704 T C 3: 9,609,364 D119G unknown Het
Zfp719 A G 7: 43,589,253 probably null Het
Other mutations in Fam111a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02565:Fam111a APN 19 12586954 missense probably damaging 0.96
IGL02721:Fam111a APN 19 12586972 missense probably benign 0.04
IGL02885:Fam111a APN 19 12584124 critical splice donor site probably null
R0121:Fam111a UTSW 19 12584080 missense probably benign 0.00
R1553:Fam111a UTSW 19 12587318 missense possibly damaging 0.93
R1583:Fam111a UTSW 19 12587778 missense probably damaging 0.99
R1837:Fam111a UTSW 19 12587452 missense probably benign 0.23
R2945:Fam111a UTSW 19 12587866 nonsense probably null
R3732:Fam111a UTSW 19 12587550 missense possibly damaging 0.57
R4772:Fam111a UTSW 19 12587693 missense probably benign
R4773:Fam111a UTSW 19 12588408 missense possibly damaging 0.91
R4894:Fam111a UTSW 19 12588549 missense probably benign 0.12
R6177:Fam111a UTSW 19 12587382 missense probably damaging 1.00
R6269:Fam111a UTSW 19 12588443 missense probably benign 0.01
R6330:Fam111a UTSW 19 12586902 missense probably damaging 1.00
R6390:Fam111a UTSW 19 12588160 nonsense probably null
R6448:Fam111a UTSW 19 12588337 missense probably benign 0.04
R6813:Fam111a UTSW 19 12587342 missense probably damaging 1.00
R7620:Fam111a UTSW 19 12587937 missense possibly damaging 0.73
R8291:Fam111a UTSW 19 12587579 missense probably benign 0.01
X0010:Fam111a UTSW 19 12588228 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATGGAAATGCAGGCTGTGCCAC -3'
(R):5'- CCAGCCCTCAGAAATCTATGCTCAG -3'

Sequencing Primer
(F):5'- GCTGTGCCACCTGCTTTG -3'
(R):5'- ATTGGAAACTCCAGCCTGGTATG -3'
Posted On2013-06-12