Incidental Mutation 'R0524:Fam111a'
ID 48813
Institutional Source Beutler Lab
Gene Symbol Fam111a
Ensembl Gene ENSMUSG00000024691
Gene Name family with sequence similarity 111, member A
Synonyms 4632417K18Rik
MMRRC Submission 038717-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R0524 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 12550874-12567133 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 12565412 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 431 (I431K)
Ref Sequence ENSEMBL: ENSMUSP00000119518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025595] [ENSMUST00000144662] [ENSMUST00000151307]
AlphaFold Q9D2L9
Predicted Effect probably damaging
Transcript: ENSMUST00000025595
AA Change: I431K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025595
Gene: ENSMUSG00000024691
AA Change: I431K

DomainStartEndE-ValueType
low complexity region 311 320 N/A INTRINSIC
Pfam:Trypsin 353 580 2.7e-7 PFAM
Pfam:Trypsin_2 368 557 6.4e-15 PFAM
Pfam:Peptidase_S7 491 574 6.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139270
Predicted Effect probably damaging
Transcript: ENSMUST00000144662
AA Change: I431K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119518
Gene: ENSMUSG00000024691
AA Change: I431K

DomainStartEndE-ValueType
low complexity region 311 320 N/A INTRINSIC
Pfam:Trypsin 353 580 2.7e-7 PFAM
Pfam:Trypsin_2 355 557 1.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151307
AA Change: I387K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123598
Gene: ENSMUSG00000024691
AA Change: I387K

DomainStartEndE-ValueType
low complexity region 267 276 N/A INTRINSIC
Pfam:Trypsin 309 536 6.6e-7 PFAM
Pfam:Trypsin_2 324 513 5.6e-15 PFAM
Pfam:Peptidase_S7 447 530 8.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224046
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is cell-cycle regulated, and has nuclear localization. The C-terminal half of the protein shares homology with trypsin-like peptidases and it contains a PCNA-interacting peptide (PIP) box, that is necessary for its co-localization with proliferating cell nuclear antigen (PCNA). Reduced expression of this gene resulted in DNA replication defects, consistent with the demonstrated role for this gene in Simian Virus 40 (SV40) viral replication. Mutations in this gene have been associated with Kenny-Caffey syndrome (KCS) type 2 and the more severe osteocraniostenosis (OCS, also known as Gracile Bone Dysplasia), both characterized by short stature, hypoparathyroidism, bone development abnormalities, and hypocalcemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,574,624 (GRCm39) probably benign Het
Adamts16 T C 13: 70,949,013 (GRCm39) E216G probably benign Het
Aoc3 C A 11: 101,228,337 (GRCm39) P715T probably damaging Het
Bnipl T C 3: 95,157,140 (GRCm39) D33G probably benign Het
Celsr2 T C 3: 108,308,903 (GRCm39) H1701R probably damaging Het
Clca3b T A 3: 144,531,082 (GRCm39) H756L probably benign Het
Clca4a A G 3: 144,675,154 (GRCm39) W159R probably damaging Het
Ddx49 A T 8: 70,749,574 (GRCm39) I252N probably damaging Het
Duox2 T C 2: 122,112,317 (GRCm39) T1290A possibly damaging Het
Fam135b A T 15: 71,334,133 (GRCm39) D1020E probably benign Het
Flii A G 11: 60,610,887 (GRCm39) V514A probably damaging Het
Frmpd1 A G 4: 45,283,774 (GRCm39) D865G probably benign Het
Frmpd1 G A 4: 45,256,902 (GRCm39) V157M probably damaging Het
Gsr G A 8: 34,159,208 (GRCm39) probably null Het
H1f11-ps T A 19: 47,158,933 (GRCm39) K214M unknown Het
Hps3 A T 3: 20,066,940 (GRCm39) V542E probably damaging Het
Kcnj5 A G 9: 32,234,270 (GRCm39) I15T probably benign Het
Kif2b T C 11: 91,466,550 (GRCm39) R578G probably benign Het
Lamb2 A G 9: 108,361,571 (GRCm39) R676G possibly damaging Het
Mrpl40 A G 16: 18,692,302 (GRCm39) F94S possibly damaging Het
Myo7b C T 18: 32,146,477 (GRCm39) V103M possibly damaging Het
Nmt2 T A 2: 3,306,474 (GRCm39) W69R probably benign Het
Nsd3 C A 8: 26,190,605 (GRCm39) Q1130K possibly damaging Het
Olfml1 T C 7: 107,189,384 (GRCm39) S150P probably damaging Het
Or2g1 A T 17: 38,106,496 (GRCm39) K54* probably null Het
Or5b116 A G 19: 13,423,228 (GRCm39) N284S probably damaging Het
Pask A T 1: 93,238,556 (GRCm39) W1310R probably damaging Het
Pcdh18 T C 3: 49,710,091 (GRCm39) Q408R probably damaging Het
Pfkm A G 15: 98,029,488 (GRCm39) I700V probably benign Het
Pias1 A G 9: 62,859,460 (GRCm39) V16A probably damaging Het
Pnpla8 C T 12: 44,330,401 (GRCm39) Q318* probably null Het
Ppp1cc C T 5: 122,310,833 (GRCm39) R142* probably null Het
Pygl T A 12: 70,254,498 (GRCm39) N149I probably damaging Het
Rapgef6 T A 11: 54,581,110 (GRCm39) S1285T probably benign Het
Rdh13 A C 7: 4,447,296 (GRCm39) C10W probably damaging Het
Rgr A T 14: 36,760,252 (GRCm39) C273S probably benign Het
Ripk4 G T 16: 97,556,487 (GRCm39) Y22* probably null Het
Slc34a2 G A 5: 53,222,215 (GRCm39) W302* probably null Het
Smarce1 G A 11: 99,104,888 (GRCm39) T263M probably damaging Het
Sypl1 C T 12: 33,017,564 (GRCm39) P94L possibly damaging Het
Tet3 A G 6: 83,356,924 (GRCm39) I878T probably damaging Het
Tmem232 A G 17: 65,792,937 (GRCm39) S87P probably damaging Het
Tmem260 A G 14: 48,709,935 (GRCm39) T163A probably benign Het
Ttn T C 2: 76,555,796 (GRCm39) Y30403C probably damaging Het
Ubash3b A T 9: 40,927,904 (GRCm39) M468K probably benign Het
Ulk4 A G 9: 121,081,717 (GRCm39) probably null Het
Vmn1r72 A G 7: 11,403,719 (GRCm39) F243S probably benign Het
Wrap73 A G 4: 154,229,764 (GRCm39) Y45C probably damaging Het
Zfp704 T C 3: 9,674,424 (GRCm39) D119G unknown Het
Zfp719 A G 7: 43,238,677 (GRCm39) probably null Het
Other mutations in Fam111a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02565:Fam111a APN 19 12,564,318 (GRCm39) missense probably damaging 0.96
IGL02721:Fam111a APN 19 12,564,336 (GRCm39) missense probably benign 0.04
IGL02885:Fam111a APN 19 12,561,488 (GRCm39) critical splice donor site probably null
R0121:Fam111a UTSW 19 12,561,444 (GRCm39) missense probably benign 0.00
R1553:Fam111a UTSW 19 12,564,682 (GRCm39) missense possibly damaging 0.93
R1583:Fam111a UTSW 19 12,565,142 (GRCm39) missense probably damaging 0.99
R1837:Fam111a UTSW 19 12,564,816 (GRCm39) missense probably benign 0.23
R2945:Fam111a UTSW 19 12,565,230 (GRCm39) nonsense probably null
R3732:Fam111a UTSW 19 12,564,914 (GRCm39) missense possibly damaging 0.57
R4772:Fam111a UTSW 19 12,565,057 (GRCm39) missense probably benign
R4773:Fam111a UTSW 19 12,565,772 (GRCm39) missense possibly damaging 0.91
R4894:Fam111a UTSW 19 12,565,913 (GRCm39) missense probably benign 0.12
R6177:Fam111a UTSW 19 12,564,746 (GRCm39) missense probably damaging 1.00
R6269:Fam111a UTSW 19 12,565,807 (GRCm39) missense probably benign 0.01
R6330:Fam111a UTSW 19 12,564,266 (GRCm39) missense probably damaging 1.00
R6390:Fam111a UTSW 19 12,565,524 (GRCm39) nonsense probably null
R6448:Fam111a UTSW 19 12,565,701 (GRCm39) missense probably benign 0.04
R6813:Fam111a UTSW 19 12,564,706 (GRCm39) missense probably damaging 1.00
R7620:Fam111a UTSW 19 12,565,301 (GRCm39) missense possibly damaging 0.73
R8291:Fam111a UTSW 19 12,564,943 (GRCm39) missense probably benign 0.01
X0010:Fam111a UTSW 19 12,565,592 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATGGAAATGCAGGCTGTGCCAC -3'
(R):5'- CCAGCCCTCAGAAATCTATGCTCAG -3'

Sequencing Primer
(F):5'- GCTGTGCCACCTGCTTTG -3'
(R):5'- ATTGGAAACTCCAGCCTGGTATG -3'
Posted On 2013-06-12