Incidental Mutation 'R6184:Gnl2'
ID488137
Institutional Source Beutler Lab
Gene Symbol Gnl2
Ensembl Gene ENSMUSG00000028869
Gene Nameguanine nucleotide binding protein-like 2 (nucleolar)
SynonymsNgp-1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R6184 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location125016585-125055380 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 125054229 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030684] [ENSMUST00000030684] [ENSMUST00000036383]
Predicted Effect probably null
Transcript: ENSMUST00000030684
SMART Domains Protein: ENSMUSP00000030684
Gene: ENSMUSG00000028869

DomainStartEndE-ValueType
Pfam:NGP1NT 43 174 1.2e-51 PFAM
SCOP:d1egaa1 178 261 8e-3 SMART
Pfam:FeoB_N 311 398 3.1e-6 PFAM
Pfam:MMR_HSR1 312 432 3.4e-13 PFAM
low complexity region 480 500 N/A INTRINSIC
low complexity region 551 579 N/A INTRINSIC
low complexity region 679 687 N/A INTRINSIC
low complexity region 700 710 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000030684
SMART Domains Protein: ENSMUSP00000030684
Gene: ENSMUSG00000028869

DomainStartEndE-ValueType
Pfam:NGP1NT 43 174 1.2e-51 PFAM
SCOP:d1egaa1 178 261 8e-3 SMART
Pfam:FeoB_N 311 398 3.1e-6 PFAM
Pfam:MMR_HSR1 312 432 3.4e-13 PFAM
low complexity region 480 500 N/A INTRINSIC
low complexity region 551 579 N/A INTRINSIC
low complexity region 679 687 N/A INTRINSIC
low complexity region 700 710 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036383
SMART Domains Protein: ENSMUSP00000047783
Gene: ENSMUSG00000042707

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
Pfam:Ax_dynein_light 66 252 1.2e-96 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147550
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik A G 12: 17,007,178 F106S probably benign Het
Adgrv1 A T 13: 81,433,838 F4696I probably benign Het
Ank2 T C 3: 126,962,398 I1073V probably damaging Het
BC048403 T C 10: 121,750,905 L375P probably damaging Het
Card11 A T 5: 140,898,278 D415E probably damaging Het
Clec16a G A 16: 10,572,928 probably null Het
Coro2a T C 4: 46,540,504 T472A probably benign Het
D130043K22Rik T A 13: 24,885,591 F878I probably damaging Het
D5Ertd579e G T 5: 36,629,783 D80E probably damaging Het
Ddrgk1 A T 2: 130,664,561 V2E possibly damaging Het
Disp1 T C 1: 183,086,332 H1508R probably benign Het
Dmtf1 T C 5: 9,126,656 N344S probably benign Het
Eml5 A G 12: 98,863,129 V503A possibly damaging Het
Fat1 A G 8: 44,953,392 H1060R probably benign Het
Fbxw8 C T 5: 118,113,749 R233Q probably damaging Het
Fer1l4 T C 2: 156,048,291 K238R probably damaging Het
Flg T A 3: 93,280,050 S270T probably benign Het
Gm10801 TC TCGCC 2: 98,663,806 probably benign Het
Gm3604 A T 13: 62,371,845 V32D probably damaging Het
Gpr162 A G 6: 124,861,241 S149P probably damaging Het
Il2ra T A 2: 11,647,979 probably benign Het
Kmt5b T A 19: 3,804,499 M254K probably damaging Het
Lrriq3 T C 3: 155,129,402 I258T probably benign Het
Mbnl1 T C 3: 60,615,744 L328S probably damaging Het
Mboat2 A G 12: 24,951,431 D277G possibly damaging Het
Mug2 A G 6: 122,037,046 I364V probably benign Het
Myh7 G A 14: 54,988,858 R442C probably damaging Het
Nin A G 12: 70,043,737 L968P probably damaging Het
Olfr1137 A T 2: 87,711,844 Y21N probably benign Het
Olfr355 T C 2: 36,927,392 T241A probably damaging Het
Olfr968 T G 9: 39,772,620 Y60S probably damaging Het
Per1 C T 11: 69,102,904 P403S probably damaging Het
Ppip5k2 T C 1: 97,734,005 I723V possibly damaging Het
Ptprg A G 14: 12,153,943 T555A probably benign Het
Rgsl1 C T 1: 153,827,448 M187I probably benign Het
Sec31a A G 5: 100,369,594 probably null Het
Sptbn5 C T 2: 120,059,417 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Het
Stx1b G A 7: 127,807,905 T206I possibly damaging Het
Tsc22d4 T A 5: 137,759,089 M35K probably damaging Het
Zc2hc1c A G 12: 85,296,444 K452E probably damaging Het
Zfp386 A G 12: 116,060,513 N582S possibly damaging Het
Zfp457 A G 13: 67,292,912 V437A possibly damaging Het
Zfp599 T C 9: 22,249,651 Y406C probably benign Het
Zfyve26 G A 12: 79,268,727 S1325F probably damaging Het
Other mutations in Gnl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Gnl2 APN 4 125047612 splice site probably null
IGL02536:Gnl2 APN 4 125052608 nonsense probably null
IGL03358:Gnl2 APN 4 125052594 missense probably damaging 1.00
PIT4283001:Gnl2 UTSW 4 125046306 missense probably damaging 1.00
R0377:Gnl2 UTSW 4 125046382 splice site probably benign
R0419:Gnl2 UTSW 4 125053527 missense probably benign 0.00
R0975:Gnl2 UTSW 4 125048378 missense probably damaging 0.99
R1529:Gnl2 UTSW 4 125046306 missense probably damaging 1.00
R1550:Gnl2 UTSW 4 125044234 missense probably damaging 1.00
R1942:Gnl2 UTSW 4 125030164 missense probably benign 0.01
R2095:Gnl2 UTSW 4 125034318 missense probably damaging 1.00
R2125:Gnl2 UTSW 4 125053485 missense probably benign 0.01
R3712:Gnl2 UTSW 4 125046274 missense probably damaging 0.98
R3781:Gnl2 UTSW 4 125037606 missense probably damaging 0.99
R4656:Gnl2 UTSW 4 125040997 nonsense probably null
R4676:Gnl2 UTSW 4 125053473 missense possibly damaging 0.83
R4710:Gnl2 UTSW 4 125053459 missense probably benign 0.01
R4734:Gnl2 UTSW 4 125041018 missense probably benign
R4916:Gnl2 UTSW 4 125043692 missense probably damaging 1.00
R5106:Gnl2 UTSW 4 125053536 critical splice donor site probably null
R5310:Gnl2 UTSW 4 125052840 missense probably benign 0.00
R5506:Gnl2 UTSW 4 125055365 utr 3 prime probably benign
R5967:Gnl2 UTSW 4 125041030 missense probably benign 0.00
R6395:Gnl2 UTSW 4 125046265 missense probably damaging 0.99
R6432:Gnl2 UTSW 4 125052560 missense possibly damaging 0.86
R6672:Gnl2 UTSW 4 125048393 missense probably damaging 1.00
R7657:Gnl2 UTSW 4 125030158 missense probably benign 0.00
RF003:Gnl2 UTSW 4 125043725 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TACACAGGGCTTGTTCCTACAG -3'
(R):5'- CTCAAAATGGACTTCTACTGCTC -3'

Sequencing Primer
(F):5'- ACAGGGCTTGTTCCTACAGTAGTC -3'
(R):5'- CAAAATGGACTTCTACTGCTCTTTTG -3'
Posted On2017-10-10