Incidental Mutation 'R0524:Or5b116'
ID 48814
Institutional Source Beutler Lab
Gene Symbol Or5b116
Ensembl Gene ENSMUSG00000096320
Gene Name olfactory receptor family 5 subfamily B member 116
Synonyms GA_x6K02T2RE5P-3777626-3778570, Olfr1471, MOR202-47_p, MOR202-38
MMRRC Submission 038717-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R0524 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 13422378-13423322 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 13423228 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 284 (N284S)
Ref Sequence ENSEMBL: ENSMUSP00000149948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096203] [ENSMUST00000217249] [ENSMUST00000217482]
AlphaFold F6QVZ8
Predicted Effect probably damaging
Transcript: ENSMUST00000096203
AA Change: N284S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093917
Gene: ENSMUSG00000096320
AA Change: N284S

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.1e-53 PFAM
Pfam:7TM_GPCR_Srsx 33 303 1.1e-8 PFAM
Pfam:7tm_1 39 288 4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213561
Predicted Effect probably damaging
Transcript: ENSMUST00000217249
AA Change: N284S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217482
AA Change: N284S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,574,624 (GRCm39) probably benign Het
Adamts16 T C 13: 70,949,013 (GRCm39) E216G probably benign Het
Aoc3 C A 11: 101,228,337 (GRCm39) P715T probably damaging Het
Bnipl T C 3: 95,157,140 (GRCm39) D33G probably benign Het
Celsr2 T C 3: 108,308,903 (GRCm39) H1701R probably damaging Het
Clca3b T A 3: 144,531,082 (GRCm39) H756L probably benign Het
Clca4a A G 3: 144,675,154 (GRCm39) W159R probably damaging Het
Ddx49 A T 8: 70,749,574 (GRCm39) I252N probably damaging Het
Duox2 T C 2: 122,112,317 (GRCm39) T1290A possibly damaging Het
Fam111a T A 19: 12,565,412 (GRCm39) I431K probably damaging Het
Fam135b A T 15: 71,334,133 (GRCm39) D1020E probably benign Het
Flii A G 11: 60,610,887 (GRCm39) V514A probably damaging Het
Frmpd1 G A 4: 45,256,902 (GRCm39) V157M probably damaging Het
Frmpd1 A G 4: 45,283,774 (GRCm39) D865G probably benign Het
Gsr G A 8: 34,159,208 (GRCm39) probably null Het
H1f11-ps T A 19: 47,158,933 (GRCm39) K214M unknown Het
Hps3 A T 3: 20,066,940 (GRCm39) V542E probably damaging Het
Kcnj5 A G 9: 32,234,270 (GRCm39) I15T probably benign Het
Kif2b T C 11: 91,466,550 (GRCm39) R578G probably benign Het
Lamb2 A G 9: 108,361,571 (GRCm39) R676G possibly damaging Het
Mrpl40 A G 16: 18,692,302 (GRCm39) F94S possibly damaging Het
Myo7b C T 18: 32,146,477 (GRCm39) V103M possibly damaging Het
Nmt2 T A 2: 3,306,474 (GRCm39) W69R probably benign Het
Nsd3 C A 8: 26,190,605 (GRCm39) Q1130K possibly damaging Het
Olfml1 T C 7: 107,189,384 (GRCm39) S150P probably damaging Het
Or2g1 A T 17: 38,106,496 (GRCm39) K54* probably null Het
Pask A T 1: 93,238,556 (GRCm39) W1310R probably damaging Het
Pcdh18 T C 3: 49,710,091 (GRCm39) Q408R probably damaging Het
Pfkm A G 15: 98,029,488 (GRCm39) I700V probably benign Het
Pias1 A G 9: 62,859,460 (GRCm39) V16A probably damaging Het
Pnpla8 C T 12: 44,330,401 (GRCm39) Q318* probably null Het
Ppp1cc C T 5: 122,310,833 (GRCm39) R142* probably null Het
Pygl T A 12: 70,254,498 (GRCm39) N149I probably damaging Het
Rapgef6 T A 11: 54,581,110 (GRCm39) S1285T probably benign Het
Rdh13 A C 7: 4,447,296 (GRCm39) C10W probably damaging Het
Rgr A T 14: 36,760,252 (GRCm39) C273S probably benign Het
Ripk4 G T 16: 97,556,487 (GRCm39) Y22* probably null Het
Slc34a2 G A 5: 53,222,215 (GRCm39) W302* probably null Het
Smarce1 G A 11: 99,104,888 (GRCm39) T263M probably damaging Het
Sypl1 C T 12: 33,017,564 (GRCm39) P94L possibly damaging Het
Tet3 A G 6: 83,356,924 (GRCm39) I878T probably damaging Het
Tmem232 A G 17: 65,792,937 (GRCm39) S87P probably damaging Het
Tmem260 A G 14: 48,709,935 (GRCm39) T163A probably benign Het
Ttn T C 2: 76,555,796 (GRCm39) Y30403C probably damaging Het
Ubash3b A T 9: 40,927,904 (GRCm39) M468K probably benign Het
Ulk4 A G 9: 121,081,717 (GRCm39) probably null Het
Vmn1r72 A G 7: 11,403,719 (GRCm39) F243S probably benign Het
Wrap73 A G 4: 154,229,764 (GRCm39) Y45C probably damaging Het
Zfp704 T C 3: 9,674,424 (GRCm39) D119G unknown Het
Zfp719 A G 7: 43,238,677 (GRCm39) probably null Het
Other mutations in Or5b116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Or5b116 APN 19 13,422,988 (GRCm39) missense probably benign 0.00
IGL01790:Or5b116 APN 19 13,422,526 (GRCm39) missense probably damaging 1.00
IGL02515:Or5b116 APN 19 13,422,472 (GRCm39) missense probably damaging 1.00
IGL02838:Or5b116 APN 19 13,423,299 (GRCm39) missense probably benign
IGL03182:Or5b116 APN 19 13,422,807 (GRCm39) missense possibly damaging 0.93
R0267:Or5b116 UTSW 19 13,422,792 (GRCm39) missense probably damaging 0.99
R1584:Or5b116 UTSW 19 13,423,023 (GRCm39) missense probably damaging 1.00
R2253:Or5b116 UTSW 19 13,422,549 (GRCm39) missense probably damaging 1.00
R5267:Or5b116 UTSW 19 13,422,475 (GRCm39) missense probably damaging 1.00
R6419:Or5b116 UTSW 19 13,423,131 (GRCm39) missense probably benign 0.00
R6495:Or5b116 UTSW 19 13,422,989 (GRCm39) missense probably benign 0.43
R7714:Or5b116 UTSW 19 13,423,252 (GRCm39) missense probably damaging 1.00
R7830:Or5b116 UTSW 19 13,422,985 (GRCm39) missense probably benign 0.33
R7882:Or5b116 UTSW 19 13,422,951 (GRCm39) missense probably benign 0.02
R7892:Or5b116 UTSW 19 13,422,662 (GRCm39) nonsense probably null
Z1088:Or5b116 UTSW 19 13,423,213 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCTGAAGCACAGAGGAAGGCATT -3'
(R):5'- CAAGATTCAAGATTCCTGTATGACCAAGACC -3'

Sequencing Primer
(F):5'- CAGAGGAAGGCATTCTCTACCTG -3'
(R):5'- tgaagggaagaaacagaaaggg -3'
Posted On 2013-06-12