Incidental Mutation 'R6184:Sec31a'
ID488140
Institutional Source Beutler Lab
Gene Symbol Sec31a
Ensembl Gene ENSMUSG00000035325
Gene NameSec31 homolog A (S. cerevisiae)
SynonymsSec31l1, 1810024J13Rik
Accession Numbers

Genbank: NM_026969; MGI: 1916412; Ensembl: ENSMUST00000046296, ENSMUST00000094578, ENSMUST00000112918

Is this an essential gene? Probably essential (E-score: 0.899) question?
Stock #R6184 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location100361649-100416234 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 100369594 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094578] [ENSMUST00000182886]
Predicted Effect probably null
Transcript: ENSMUST00000094578
SMART Domains Protein: ENSMUSP00000092157
Gene: ENSMUSG00000035325

DomainStartEndE-ValueType
WD40 56 102 1.59e1 SMART
WD40 111 151 5.15e-2 SMART
WD40 158 197 5.16e-1 SMART
WD40 200 245 6.63e0 SMART
WD40 249 289 1.95e-2 SMART
WD40 292 332 4.24e-3 SMART
low complexity region 363 373 N/A INTRINSIC
Pfam:Sec16_C 572 769 3.5e-7 PFAM
low complexity region 866 882 N/A INTRINSIC
low complexity region 930 949 N/A INTRINSIC
low complexity region 953 975 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182002
Predicted Effect probably null
Transcript: ENSMUST00000182433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182569
Predicted Effect probably benign
Transcript: ENSMUST00000182812
Predicted Effect probably null
Transcript: ENSMUST00000182886
SMART Domains Protein: ENSMUSP00000138213
Gene: ENSMUSG00000035325

DomainStartEndE-ValueType
WD40 56 102 1e-1 SMART
WD40 111 151 3.3e-4 SMART
WD40 158 197 3.2e-3 SMART
WD40 200 245 4.1e-2 SMART
WD40 249 289 1.2e-4 SMART
WD40 292 332 2.6e-5 SMART
low complexity region 363 373 N/A INTRINSIC
Pfam:Sec16_C 532 731 2.1e-6 PFAM
low complexity region 827 843 N/A INTRINSIC
low complexity region 891 910 N/A INTRINSIC
low complexity region 914 936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182988
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with the yeast Sec31 protein, and is a component of the outer layer of the coat protein complex II (COPII). The encoded protein is involved in vesicle budding from the endoplasmic reticulum (ER) and contains multiple WD repeats near the N-terminus and a proline-rich region in the C-terminal half. It associates with the protein encoded by the SEC13 homolog, nuclear pore and COPII coat complex component (SEC13), and is required for ER-Golgi transport. Monoubiquitylation of this protein by CUL3-KLHL12 was found to regulate the size of COPII coats to accommodate unusually shaped cargo. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(31) : Gene trapped(31)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik A G 12: 17,007,178 F106S probably benign Het
Adgrv1 A T 13: 81,433,838 F4696I probably benign Het
Ank2 T C 3: 126,962,398 I1073V probably damaging Het
BC048403 T C 10: 121,750,905 L375P probably damaging Het
Card11 A T 5: 140,898,278 D415E probably damaging Het
Clec16a G A 16: 10,572,928 probably null Het
Coro2a T C 4: 46,540,504 T472A probably benign Het
D130043K22Rik T A 13: 24,885,591 F878I probably damaging Het
D5Ertd579e G T 5: 36,629,783 D80E probably damaging Het
Ddrgk1 A T 2: 130,664,561 V2E possibly damaging Het
Disp1 T C 1: 183,086,332 H1508R probably benign Het
Dmtf1 T C 5: 9,126,656 N344S probably benign Het
Eml5 A G 12: 98,863,129 V503A possibly damaging Het
Fat1 A G 8: 44,953,392 H1060R probably benign Het
Fbxw8 C T 5: 118,113,749 R233Q probably damaging Het
Fer1l4 T C 2: 156,048,291 K238R probably damaging Het
Flg T A 3: 93,280,050 S270T probably benign Het
Gm10801 TC TCGCC 2: 98,663,806 probably benign Het
Gm3604 A T 13: 62,371,845 V32D probably damaging Het
Gnl2 T G 4: 125,054,229 probably null Het
Gpr162 A G 6: 124,861,241 S149P probably damaging Het
Il2ra T A 2: 11,647,979 probably benign Het
Kmt5b T A 19: 3,804,499 M254K probably damaging Het
Lrriq3 T C 3: 155,129,402 I258T probably benign Het
Mbnl1 T C 3: 60,615,744 L328S probably damaging Het
Mboat2 A G 12: 24,951,431 D277G possibly damaging Het
Mug2 A G 6: 122,037,046 I364V probably benign Het
Myh7 G A 14: 54,988,858 R442C probably damaging Het
Nin A G 12: 70,043,737 L968P probably damaging Het
Olfr1137 A T 2: 87,711,844 Y21N probably benign Het
Olfr355 T C 2: 36,927,392 T241A probably damaging Het
Olfr968 T G 9: 39,772,620 Y60S probably damaging Het
Per1 C T 11: 69,102,904 P403S probably damaging Het
Ppip5k2 T C 1: 97,734,005 I723V possibly damaging Het
Ptprg A G 14: 12,153,943 T555A probably benign Het
Rgsl1 C T 1: 153,827,448 M187I probably benign Het
Sptbn5 C T 2: 120,059,417 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Het
Stx1b G A 7: 127,807,905 T206I possibly damaging Het
Tsc22d4 T A 5: 137,759,089 M35K probably damaging Het
Zc2hc1c A G 12: 85,296,444 K452E probably damaging Het
Zfp386 A G 12: 116,060,513 N582S possibly damaging Het
Zfp457 A G 13: 67,292,912 V437A possibly damaging Het
Zfp599 T C 9: 22,249,651 Y406C probably benign Het
Zfyve26 G A 12: 79,268,727 S1325F probably damaging Het
Other mutations in Sec31a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Sec31a APN 5 100404017 nonsense probably null
IGL01610:Sec31a APN 5 100402358 splice site probably benign
IGL01804:Sec31a APN 5 100375206 critical splice donor site probably null
IGL02026:Sec31a APN 5 100369626 missense probably benign 0.04
IGL02150:Sec31a APN 5 100386125 splice site probably benign
IGL02237:Sec31a APN 5 100362055 missense probably damaging 1.00
IGL02469:Sec31a APN 5 100385255 missense probably benign 0.02
IGL02512:Sec31a APN 5 100407193 missense probably damaging 0.99
control UTSW 5 100362173 missense probably damaging 1.00
Discipline UTSW 5 100363878 missense probably damaging 1.00
D3080:Sec31a UTSW 5 100363832 missense probably damaging 1.00
PIT4142001:Sec31a UTSW 5 100407275 missense probably damaging 1.00
R0366:Sec31a UTSW 5 100382766 missense probably damaging 1.00
R0453:Sec31a UTSW 5 100404118 splice site probably benign
R0511:Sec31a UTSW 5 100375240 missense probably benign 0.01
R0546:Sec31a UTSW 5 100404070 missense probably damaging 1.00
R0675:Sec31a UTSW 5 100393207 missense probably damaging 0.97
R0678:Sec31a UTSW 5 100407225 missense possibly damaging 0.74
R0975:Sec31a UTSW 5 100395904 unclassified probably null
R1146:Sec31a UTSW 5 100362173 missense probably damaging 1.00
R1146:Sec31a UTSW 5 100362173 missense probably damaging 1.00
R1540:Sec31a UTSW 5 100375319 missense probably damaging 1.00
R1616:Sec31a UTSW 5 100386195 missense possibly damaging 0.88
R1780:Sec31a UTSW 5 100381336 splice site probably null
R2472:Sec31a UTSW 5 100385205 missense probably damaging 1.00
R3689:Sec31a UTSW 5 100382907 missense probably damaging 1.00
R4515:Sec31a UTSW 5 100365958 missense probably damaging 0.99
R4801:Sec31a UTSW 5 100393363 missense probably damaging 0.96
R4802:Sec31a UTSW 5 100393363 missense probably damaging 0.96
R4896:Sec31a UTSW 5 100368333 missense probably damaging 1.00
R5004:Sec31a UTSW 5 100368333 missense probably damaging 1.00
R5053:Sec31a UTSW 5 100393214 missense possibly damaging 0.94
R5158:Sec31a UTSW 5 100393321 missense probably damaging 0.99
R5191:Sec31a UTSW 5 100405511 missense possibly damaging 0.75
R5222:Sec31a UTSW 5 100382895 missense probably benign
R5405:Sec31a UTSW 5 100383798 nonsense probably null
R5436:Sec31a UTSW 5 100363839 missense probably damaging 0.98
R5577:Sec31a UTSW 5 100402274 missense possibly damaging 0.95
R6005:Sec31a UTSW 5 100363878 missense probably damaging 1.00
R6245:Sec31a UTSW 5 100386184 missense probably benign 0.07
R6475:Sec31a UTSW 5 100385270 missense probably damaging 1.00
R6476:Sec31a UTSW 5 100386149 missense probably benign 0.03
R6744:Sec31a UTSW 5 100392499 missense possibly damaging 0.47
R6804:Sec31a UTSW 5 100382812 missense probably benign 0.03
R6911:Sec31a UTSW 5 100393264 missense possibly damaging 0.92
R6936:Sec31a UTSW 5 100392510 missense probably benign
R7345:Sec31a UTSW 5 100385270 missense probably damaging 1.00
R7760:Sec31a UTSW 5 100392628 missense probably damaging 1.00
R7898:Sec31a UTSW 5 100399477 missense probably damaging 0.99
R8088:Sec31a UTSW 5 100378862 missense
X0003:Sec31a UTSW 5 100399354 missense probably damaging 0.98
Z1177:Sec31a UTSW 5 100383845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGACAGGCAGCGTCCATG -3'
(R):5'- AGGCTATCTAGTTAGAGACTCTGC -3'

Sequencing Primer
(F):5'- CGTCCATGATTAAAACTGGGAGTC -3'
(R):5'- GTTAGAGACTCTGCCAATAAGTAAG -3'
Posted On2017-10-10