Incidental Mutation 'R6184:Fbxw8'
ID488141
Institutional Source Beutler Lab
Gene Symbol Fbxw8
Ensembl Gene ENSMUSG00000032867
Gene NameF-box and WD-40 domain protein 8
SynonymsFbx29, FBW6, FBXO29, 4930438M06Rik, FBW8
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R6184 (G1)
Quality Score112.008
Status Not validated
Chromosome5
Chromosomal Location118064965-118155464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 118113749 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 233 (R233Q)
Ref Sequence ENSEMBL: ENSMUSP00000047012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049474]
Predicted Effect probably damaging
Transcript: ENSMUST00000049474
AA Change: R233Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047012
Gene: ENSMUSG00000032867
AA Change: R233Q

DomainStartEndE-ValueType
low complexity region 16 39 N/A INTRINSIC
low complexity region 51 75 N/A INTRINSIC
low complexity region 76 91 N/A INTRINSIC
FBOX 119 159 5e-5 SMART
WD40 198 236 6.16e0 SMART
WD40 248 285 7.1e1 SMART
WD40 289 327 7.36e1 SMART
Blast:WD40 373 418 2e-8 BLAST
WD40 421 461 1.6e0 SMART
WD40 464 501 2.15e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201545
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene contains a WD-40 domain, in addition to an F-box motif, so it belongs to the Fbw class. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display partial late embryonic lethality with embryonic growth retardation and abnormal placental morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik A G 12: 17,007,178 F106S probably benign Het
Adgrv1 A T 13: 81,433,838 F4696I probably benign Het
Ank2 T C 3: 126,962,398 I1073V probably damaging Het
BC048403 T C 10: 121,750,905 L375P probably damaging Het
Card11 A T 5: 140,898,278 D415E probably damaging Het
Clec16a G A 16: 10,572,928 probably null Het
Coro2a T C 4: 46,540,504 T472A probably benign Het
D130043K22Rik T A 13: 24,885,591 F878I probably damaging Het
D5Ertd579e G T 5: 36,629,783 D80E probably damaging Het
Ddrgk1 A T 2: 130,664,561 V2E possibly damaging Het
Disp1 T C 1: 183,086,332 H1508R probably benign Het
Dmtf1 T C 5: 9,126,656 N344S probably benign Het
Eml5 A G 12: 98,863,129 V503A possibly damaging Het
Fat1 A G 8: 44,953,392 H1060R probably benign Het
Fer1l4 T C 2: 156,048,291 K238R probably damaging Het
Flg T A 3: 93,280,050 S270T probably benign Het
Gm10801 TC TCGCC 2: 98,663,806 probably benign Het
Gm3604 A T 13: 62,371,845 V32D probably damaging Het
Gnl2 T G 4: 125,054,229 probably null Het
Gpr162 A G 6: 124,861,241 S149P probably damaging Het
Il2ra T A 2: 11,647,979 probably benign Het
Kmt5b T A 19: 3,804,499 M254K probably damaging Het
Lrriq3 T C 3: 155,129,402 I258T probably benign Het
Mbnl1 T C 3: 60,615,744 L328S probably damaging Het
Mboat2 A G 12: 24,951,431 D277G possibly damaging Het
Mug2 A G 6: 122,037,046 I364V probably benign Het
Myh7 G A 14: 54,988,858 R442C probably damaging Het
Nin A G 12: 70,043,737 L968P probably damaging Het
Olfr1137 A T 2: 87,711,844 Y21N probably benign Het
Olfr355 T C 2: 36,927,392 T241A probably damaging Het
Olfr968 T G 9: 39,772,620 Y60S probably damaging Het
Per1 C T 11: 69,102,904 P403S probably damaging Het
Ppip5k2 T C 1: 97,734,005 I723V possibly damaging Het
Ptprg A G 14: 12,153,943 T555A probably benign Het
Rgsl1 C T 1: 153,827,448 M187I probably benign Het
Sec31a A G 5: 100,369,594 probably null Het
Sptbn5 C T 2: 120,059,417 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Het
Stx1b G A 7: 127,807,905 T206I possibly damaging Het
Tsc22d4 T A 5: 137,759,089 M35K probably damaging Het
Zc2hc1c A G 12: 85,296,444 K452E probably damaging Het
Zfp386 A G 12: 116,060,513 N582S possibly damaging Het
Zfp457 A G 13: 67,292,912 V437A possibly damaging Het
Zfp599 T C 9: 22,249,651 Y406C probably benign Het
Zfyve26 G A 12: 79,268,727 S1325F probably damaging Het
Other mutations in Fbxw8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Fbxw8 APN 5 118068097 missense probably benign 0.00
IGL00435:Fbxw8 APN 5 118068137 missense probably benign 0.01
IGL00674:Fbxw8 APN 5 118095593 missense possibly damaging 0.94
IGL01306:Fbxw8 APN 5 118113720 missense possibly damaging 0.88
IGL02389:Fbxw8 APN 5 118128955 missense possibly damaging 0.57
IGL02438:Fbxw8 APN 5 118095693 missense probably benign 0.09
IGL02553:Fbxw8 APN 5 118066060 unclassified probably benign
IGL02752:Fbxw8 APN 5 118142750 missense probably damaging 1.00
IGL02975:Fbxw8 APN 5 118077695 missense probably benign 0.02
IGL03177:Fbxw8 APN 5 118128980 splice site probably benign
IGL03333:Fbxw8 APN 5 118095595 missense possibly damaging 0.94
IGL03407:Fbxw8 APN 5 118142676 missense probably damaging 1.00
ANU23:Fbxw8 UTSW 5 118113720 missense possibly damaging 0.88
R0135:Fbxw8 UTSW 5 118070487 missense probably damaging 1.00
R0760:Fbxw8 UTSW 5 118065901 unclassified probably null
R1115:Fbxw8 UTSW 5 118077571 splice site probably benign
R1498:Fbxw8 UTSW 5 118065785 unclassified probably benign
R1689:Fbxw8 UTSW 5 118077617 missense probably damaging 0.97
R1897:Fbxw8 UTSW 5 118128876 missense probably benign 0.16
R2160:Fbxw8 UTSW 5 118124988 missense probably damaging 1.00
R2345:Fbxw8 UTSW 5 118065807 unclassified probably benign
R3743:Fbxw8 UTSW 5 118113639 missense probably damaging 1.00
R3935:Fbxw8 UTSW 5 118095718 missense probably benign 0.38
R4910:Fbxw8 UTSW 5 118125027 splice site probably null
R5220:Fbxw8 UTSW 5 118095711 missense possibly damaging 0.69
R5628:Fbxw8 UTSW 5 118092557 missense probably damaging 1.00
R6161:Fbxw8 UTSW 5 118092675 missense possibly damaging 0.94
R6582:Fbxw8 UTSW 5 118124963 missense probably benign 0.28
R6617:Fbxw8 UTSW 5 118142666 critical splice donor site probably null
R6785:Fbxw8 UTSW 5 118092689 missense probably damaging 1.00
R7363:Fbxw8 UTSW 5 118124992 missense probably damaging 0.97
R7395:Fbxw8 UTSW 5 118068215 missense probably damaging 1.00
R7674:Fbxw8 UTSW 5 118124971 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGTGCATGCTCAGAGGAG -3'
(R):5'- TTCCTCACTCAAACCACTGTAGG -3'

Sequencing Primer
(F):5'- AGGCTTTCTCTGAGACGGG -3'
(R):5'- TGTAGGAACAGGGCCTCC -3'
Posted On2017-10-10