Incidental Mutation 'R6184:Tsc22d4'
ID488142
Institutional Source Beutler Lab
Gene Symbol Tsc22d4
Ensembl Gene ENSMUSG00000029723
Gene NameTSC22 domain family, member 4
Synonyms0610009M14Rik, 1700023B23Rik, Thg-1pit
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6184 (G1)
Quality Score95.0077
Status Not validated
Chromosome5
Chromosomal Location137745730-137768450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 137759089 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 35 (M35K)
Ref Sequence ENSEMBL: ENSMUSP00000120835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031738] [ENSMUST00000100539] [ENSMUST00000100540] [ENSMUST00000110983] [ENSMUST00000110985] [ENSMUST00000141733]
Predicted Effect probably benign
Transcript: ENSMUST00000031738
SMART Domains Protein: ENSMUSP00000031738
Gene: ENSMUSG00000029723

DomainStartEndE-ValueType
low complexity region 89 104 N/A INTRINSIC
low complexity region 167 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100539
AA Change: M326K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000098107
Gene: ENSMUSG00000029723
AA Change: M326K

DomainStartEndE-ValueType
low complexity region 31 61 N/A INTRINSIC
low complexity region 111 123 N/A INTRINSIC
low complexity region 190 199 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
Pfam:TSC22 318 377 5.9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100540
SMART Domains Protein: ENSMUSP00000098108
Gene: ENSMUSG00000029723

DomainStartEndE-ValueType
low complexity region 31 61 N/A INTRINSIC
low complexity region 111 123 N/A INTRINSIC
low complexity region 190 199 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
Pfam:DUF4703 319 509 4.5e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110983
SMART Domains Protein: ENSMUSP00000106611
Gene: ENSMUSG00000029723

DomainStartEndE-ValueType
Pfam:DUF4703 20 136 1.6e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110985
AA Change: M107K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106613
Gene: ENSMUSG00000029723
AA Change: M107K

DomainStartEndE-ValueType
Pfam:TSC22 99 158 9.1e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129399
Predicted Effect probably damaging
Transcript: ENSMUST00000141733
AA Change: M35K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120835
Gene: ENSMUSG00000029723
AA Change: M35K

DomainStartEndE-ValueType
Pfam:TSC22 27 82 6.6e-32 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TSC22D4 is a member of the TSC22 domain family of leucine zipper transcriptional regulators (see TSC22D3; MIM 300506) (Kester et al., 1999 [PubMed 10488076]; Fiorenza et al., 2001 [PubMed 11707329]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik A G 12: 17,007,178 F106S probably benign Het
Adgrv1 A T 13: 81,433,838 F4696I probably benign Het
Ank2 T C 3: 126,962,398 I1073V probably damaging Het
BC048403 T C 10: 121,750,905 L375P probably damaging Het
Card11 A T 5: 140,898,278 D415E probably damaging Het
Clec16a G A 16: 10,572,928 probably null Het
Coro2a T C 4: 46,540,504 T472A probably benign Het
D130043K22Rik T A 13: 24,885,591 F878I probably damaging Het
D5Ertd579e G T 5: 36,629,783 D80E probably damaging Het
Ddrgk1 A T 2: 130,664,561 V2E possibly damaging Het
Disp1 T C 1: 183,086,332 H1508R probably benign Het
Dmtf1 T C 5: 9,126,656 N344S probably benign Het
Eml5 A G 12: 98,863,129 V503A possibly damaging Het
Fat1 A G 8: 44,953,392 H1060R probably benign Het
Fbxw8 C T 5: 118,113,749 R233Q probably damaging Het
Fer1l4 T C 2: 156,048,291 K238R probably damaging Het
Flg T A 3: 93,280,050 S270T probably benign Het
Gm10801 TC TCGCC 2: 98,663,806 probably benign Het
Gm3604 A T 13: 62,371,845 V32D probably damaging Het
Gnl2 T G 4: 125,054,229 probably null Het
Gpr162 A G 6: 124,861,241 S149P probably damaging Het
Il2ra T A 2: 11,647,979 probably benign Het
Kmt5b T A 19: 3,804,499 M254K probably damaging Het
Lrriq3 T C 3: 155,129,402 I258T probably benign Het
Mbnl1 T C 3: 60,615,744 L328S probably damaging Het
Mboat2 A G 12: 24,951,431 D277G possibly damaging Het
Mug2 A G 6: 122,037,046 I364V probably benign Het
Myh7 G A 14: 54,988,858 R442C probably damaging Het
Nin A G 12: 70,043,737 L968P probably damaging Het
Olfr1137 A T 2: 87,711,844 Y21N probably benign Het
Olfr355 T C 2: 36,927,392 T241A probably damaging Het
Olfr968 T G 9: 39,772,620 Y60S probably damaging Het
Per1 C T 11: 69,102,904 P403S probably damaging Het
Ppip5k2 T C 1: 97,734,005 I723V possibly damaging Het
Ptprg A G 14: 12,153,943 T555A probably benign Het
Rgsl1 C T 1: 153,827,448 M187I probably benign Het
Sec31a A G 5: 100,369,594 probably null Het
Sptbn5 C T 2: 120,059,417 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Het
Stx1b G A 7: 127,807,905 T206I possibly damaging Het
Zc2hc1c A G 12: 85,296,444 K452E probably damaging Het
Zfp386 A G 12: 116,060,513 N582S possibly damaging Het
Zfp457 A G 13: 67,292,912 V437A possibly damaging Het
Zfp599 T C 9: 22,249,651 Y406C probably benign Het
Zfyve26 G A 12: 79,268,727 S1325F probably damaging Het
Other mutations in Tsc22d4
AlleleSourceChrCoordTypePredicted EffectPPH Score
mastodon UTSW 5 137751370 critical splice donor site probably null
R0103:Tsc22d4 UTSW 5 137747116 start codon destroyed possibly damaging 0.79
R0570:Tsc22d4 UTSW 5 137762419 missense possibly damaging 0.85
R0600:Tsc22d4 UTSW 5 137762655 missense probably damaging 0.97
R0658:Tsc22d4 UTSW 5 137768021 missense probably benign
R2073:Tsc22d4 UTSW 5 137762487 missense possibly damaging 0.45
R3772:Tsc22d4 UTSW 5 137759233 missense possibly damaging 0.86
R4012:Tsc22d4 UTSW 5 137758328 missense probably benign 0.02
R4232:Tsc22d4 UTSW 5 137751370 critical splice donor site probably null
R5378:Tsc22d4 UTSW 5 137762464 missense probably damaging 0.99
R5394:Tsc22d4 UTSW 5 137758774 intron probably benign
R5677:Tsc22d4 UTSW 5 137747142 missense probably damaging 1.00
R5765:Tsc22d4 UTSW 5 137758543 missense probably benign 0.04
R6263:Tsc22d4 UTSW 5 137768179 missense possibly damaging 0.85
R6700:Tsc22d4 UTSW 5 137758523 missense probably benign 0.04
R6821:Tsc22d4 UTSW 5 137762644 missense possibly damaging 0.92
R6877:Tsc22d4 UTSW 5 137762593 missense possibly damaging 0.85
R7354:Tsc22d4 UTSW 5 137768109 missense probably benign 0.12
R7376:Tsc22d4 UTSW 5 137758152 missense unknown
R7499:Tsc22d4 UTSW 5 137747723 missense probably benign 0.19
R7731:Tsc22d4 UTSW 5 137758694 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AACCTCCATCCCTGTCTGAG -3'
(R):5'- CCCAAAGGCACATTGTGAGG -3'

Sequencing Primer
(F):5'- TTGACCGACTGCTGCCCTG -3'
(R):5'- AGGCTCAGATGGAGGGCC -3'
Posted On2017-10-10