Incidental Mutation 'R6184:Mug2'
ID 488144
Institutional Source Beutler Lab
Gene Symbol Mug2
Ensembl Gene ENSMUSG00000030131
Gene Name murinoglobulin 2
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R6184 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 121983720-122062924 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 122014005 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 364 (I364V)
Ref Sequence ENSEMBL: ENSMUSP00000080469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081777]
AlphaFold P28666
Predicted Effect probably benign
Transcript: ENSMUST00000081777
AA Change: I364V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080469
Gene: ENSMUSG00000030131
AA Change: I364V

DomainStartEndE-ValueType
Pfam:A2M_N 128 221 3.5e-21 PFAM
A2M_N_2 449 599 1.05e-42 SMART
low complexity region 711 728 N/A INTRINSIC
A2M 740 830 7.16e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
low complexity region 994 1005 N/A INTRINSIC
Pfam:A2M_comp 1012 1097 5.8e-34 PFAM
Pfam:A2M_comp 1093 1243 3e-47 PFAM
A2M_recep 1353 1440 1.85e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204290
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik A G 12: 17,057,179 (GRCm39) F106S probably benign Het
Adgrv1 A T 13: 81,581,957 (GRCm39) F4696I probably benign Het
Ank2 T C 3: 126,756,047 (GRCm39) I1073V probably damaging Het
Card11 A T 5: 140,884,033 (GRCm39) D415E probably damaging Het
Clec16a G A 16: 10,390,792 (GRCm39) probably null Het
Coro2a T C 4: 46,540,504 (GRCm39) T472A probably benign Het
D130043K22Rik T A 13: 25,069,574 (GRCm39) F878I probably damaging Het
D5Ertd579e G T 5: 36,787,127 (GRCm39) D80E probably damaging Het
Ddrgk1 A T 2: 130,506,481 (GRCm39) V2E possibly damaging Het
Disp1 T C 1: 182,867,896 (GRCm39) H1508R probably benign Het
Dmtf1 T C 5: 9,176,656 (GRCm39) N344S probably benign Het
Eml5 A G 12: 98,829,388 (GRCm39) V503A possibly damaging Het
Fat1 A G 8: 45,406,429 (GRCm39) H1060R probably benign Het
Fbxw8 C T 5: 118,251,814 (GRCm39) R233Q probably damaging Het
Fer1l4 T C 2: 155,890,211 (GRCm39) K238R probably damaging Het
Flg T A 3: 93,187,357 (GRCm39) S270T probably benign Het
Gm10801 TC TCGCC 2: 98,494,151 (GRCm39) probably benign Het
Gm3604 A T 13: 62,519,659 (GRCm39) V32D probably damaging Het
Gnl2 T G 4: 124,948,022 (GRCm39) probably null Het
Gpr162 A G 6: 124,838,204 (GRCm39) S149P probably damaging Het
Il2ra T A 2: 11,652,790 (GRCm39) probably benign Het
Kics2 T C 10: 121,586,810 (GRCm39) L375P probably damaging Het
Kmt5b T A 19: 3,854,499 (GRCm39) M254K probably damaging Het
Lrriq3 T C 3: 154,835,039 (GRCm39) I258T probably benign Het
Mbnl1 T C 3: 60,523,165 (GRCm39) L328S probably damaging Het
Mboat2 A G 12: 25,001,430 (GRCm39) D277G possibly damaging Het
Myh7 G A 14: 55,226,315 (GRCm39) R442C probably damaging Het
Nin A G 12: 70,090,511 (GRCm39) L968P probably damaging Het
Or1l8 T C 2: 36,817,404 (GRCm39) T241A probably damaging Het
Or5w14 A T 2: 87,542,188 (GRCm39) Y21N probably benign Het
Or8g53 T G 9: 39,683,916 (GRCm39) Y60S probably damaging Het
Per1 C T 11: 68,993,730 (GRCm39) P403S probably damaging Het
Ppip5k2 T C 1: 97,661,730 (GRCm39) I723V possibly damaging Het
Ptprg A G 14: 12,153,943 (GRCm38) T555A probably benign Het
Rgsl1 C T 1: 153,703,194 (GRCm39) M187I probably benign Het
Sec31a A G 5: 100,517,453 (GRCm39) probably null Het
Sptbn5 C T 2: 119,889,898 (GRCm39) probably benign Het
Sry C G Y: 2,662,975 (GRCm39) Q228H unknown Het
Stx1b G A 7: 127,407,077 (GRCm39) T206I possibly damaging Het
Tsc22d4 T A 5: 137,757,351 (GRCm39) M35K probably damaging Het
Zc2hc1c A G 12: 85,343,218 (GRCm39) K452E probably damaging Het
Zfp386 A G 12: 116,024,133 (GRCm39) N582S possibly damaging Het
Zfp457 A G 13: 67,440,976 (GRCm39) V437A possibly damaging Het
Zfp599 T C 9: 22,160,947 (GRCm39) Y406C probably benign Het
Zfyve26 G A 12: 79,315,501 (GRCm39) S1325F probably damaging Het
Other mutations in Mug2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mug2 APN 6 122,024,446 (GRCm39) missense possibly damaging 0.83
IGL00957:Mug2 APN 6 122,017,613 (GRCm39) missense probably damaging 0.99
IGL01314:Mug2 APN 6 122,058,238 (GRCm39) missense possibly damaging 0.62
IGL01338:Mug2 APN 6 122,026,587 (GRCm39) splice site probably benign
IGL01477:Mug2 APN 6 122,058,643 (GRCm39) splice site probably benign
IGL01926:Mug2 APN 6 122,013,063 (GRCm39) splice site probably benign
IGL02019:Mug2 APN 6 122,024,394 (GRCm39) missense probably benign 0.02
IGL02305:Mug2 APN 6 122,013,015 (GRCm39) missense probably benign
IGL02310:Mug2 APN 6 122,036,082 (GRCm39) splice site probably benign
IGL02484:Mug2 APN 6 122,049,712 (GRCm39) missense probably damaging 1.00
IGL02516:Mug2 APN 6 122,047,802 (GRCm39) missense probably damaging 1.00
IGL02531:Mug2 APN 6 122,049,730 (GRCm39) missense probably damaging 1.00
IGL02666:Mug2 APN 6 122,058,285 (GRCm39) missense probably damaging 1.00
IGL02936:Mug2 APN 6 122,058,346 (GRCm39) critical splice donor site probably null
R0114:Mug2 UTSW 6 122,017,607 (GRCm39) missense probably damaging 1.00
R0119:Mug2 UTSW 6 122,013,022 (GRCm39) missense probably benign 0.00
R0123:Mug2 UTSW 6 122,051,673 (GRCm39) missense possibly damaging 0.89
R0144:Mug2 UTSW 6 122,047,970 (GRCm39) splice site probably benign
R0225:Mug2 UTSW 6 122,051,673 (GRCm39) missense possibly damaging 0.89
R0514:Mug2 UTSW 6 122,058,558 (GRCm39) missense probably damaging 1.00
R0763:Mug2 UTSW 6 122,052,253 (GRCm39) missense probably benign
R0959:Mug2 UTSW 6 122,062,454 (GRCm39) missense probably benign 0.33
R1104:Mug2 UTSW 6 122,036,014 (GRCm39) missense probably benign
R1239:Mug2 UTSW 6 122,058,637 (GRCm39) splice site probably benign
R1318:Mug2 UTSW 6 122,054,361 (GRCm39) missense probably damaging 1.00
R1460:Mug2 UTSW 6 122,017,492 (GRCm39) splice site probably benign
R1706:Mug2 UTSW 6 122,013,191 (GRCm39) splice site probably benign
R1761:Mug2 UTSW 6 122,051,664 (GRCm39) missense probably benign 0.20
R1901:Mug2 UTSW 6 122,048,801 (GRCm39) missense probably benign 0.02
R1913:Mug2 UTSW 6 122,047,829 (GRCm39) missense probably damaging 1.00
R1943:Mug2 UTSW 6 122,056,598 (GRCm39) missense probably benign
R2054:Mug2 UTSW 6 122,054,451 (GRCm39) missense probably damaging 1.00
R2060:Mug2 UTSW 6 122,056,571 (GRCm39) missense probably benign
R2420:Mug2 UTSW 6 122,060,419 (GRCm39) missense probably damaging 1.00
R2432:Mug2 UTSW 6 122,061,335 (GRCm39) missense possibly damaging 0.93
R2916:Mug2 UTSW 6 122,051,683 (GRCm39) splice site probably null
R2918:Mug2 UTSW 6 122,051,683 (GRCm39) splice site probably null
R3423:Mug2 UTSW 6 122,024,465 (GRCm39) splice site probably benign
R3834:Mug2 UTSW 6 122,026,746 (GRCm39) critical splice donor site probably null
R3902:Mug2 UTSW 6 122,052,526 (GRCm39) missense probably damaging 1.00
R3941:Mug2 UTSW 6 122,040,522 (GRCm39) missense probably benign
R4227:Mug2 UTSW 6 122,017,691 (GRCm39) missense probably benign 0.10
R4284:Mug2 UTSW 6 122,040,632 (GRCm39) missense probably benign 0.00
R4287:Mug2 UTSW 6 122,040,632 (GRCm39) missense probably benign 0.00
R4377:Mug2 UTSW 6 122,047,966 (GRCm39) critical splice donor site probably null
R4419:Mug2 UTSW 6 122,056,589 (GRCm39) missense probably damaging 1.00
R4498:Mug2 UTSW 6 122,059,711 (GRCm39) missense probably damaging 0.99
R4566:Mug2 UTSW 6 122,056,597 (GRCm39) missense probably benign 0.00
R4690:Mug2 UTSW 6 122,013,255 (GRCm39) missense probably benign
R4732:Mug2 UTSW 6 122,048,831 (GRCm39) missense probably damaging 0.99
R4733:Mug2 UTSW 6 122,048,831 (GRCm39) missense probably damaging 0.99
R4741:Mug2 UTSW 6 122,056,572 (GRCm39) missense probably benign
R4888:Mug2 UTSW 6 122,058,154 (GRCm39) missense probably damaging 1.00
R5199:Mug2 UTSW 6 122,017,619 (GRCm39) missense probably benign
R5347:Mug2 UTSW 6 122,058,551 (GRCm39) missense probably damaging 1.00
R5457:Mug2 UTSW 6 122,026,688 (GRCm39) nonsense probably null
R5495:Mug2 UTSW 6 122,056,609 (GRCm39) missense probably damaging 0.96
R5509:Mug2 UTSW 6 122,061,340 (GRCm39) missense possibly damaging 0.84
R6006:Mug2 UTSW 6 122,060,459 (GRCm39) missense probably null 0.98
R6180:Mug2 UTSW 6 122,056,565 (GRCm39) missense probably benign 0.01
R6199:Mug2 UTSW 6 122,024,398 (GRCm39) missense probably benign 0.05
R6262:Mug2 UTSW 6 122,052,214 (GRCm39) missense probably damaging 1.00
R6416:Mug2 UTSW 6 122,059,713 (GRCm39) missense probably damaging 1.00
R6548:Mug2 UTSW 6 122,024,401 (GRCm39) missense probably damaging 1.00
R6703:Mug2 UTSW 6 122,055,653 (GRCm39) missense probably benign 0.25
R7106:Mug2 UTSW 6 122,059,680 (GRCm39) missense probably damaging 1.00
R7131:Mug2 UTSW 6 122,052,206 (GRCm39) missense probably damaging 1.00
R7372:Mug2 UTSW 6 122,060,425 (GRCm39) missense possibly damaging 0.88
R7379:Mug2 UTSW 6 122,024,446 (GRCm39) missense possibly damaging 0.83
R7419:Mug2 UTSW 6 122,017,529 (GRCm39) missense possibly damaging 0.86
R7423:Mug2 UTSW 6 122,056,685 (GRCm39) missense probably benign 0.00
R7581:Mug2 UTSW 6 122,040,670 (GRCm39) missense probably damaging 1.00
R7582:Mug2 UTSW 6 122,056,603 (GRCm39) missense probably damaging 0.99
R7672:Mug2 UTSW 6 122,017,678 (GRCm39) missense probably benign 0.37
R7713:Mug2 UTSW 6 122,055,754 (GRCm39) missense possibly damaging 0.83
R7759:Mug2 UTSW 6 122,058,317 (GRCm39) missense probably damaging 1.00
R7834:Mug2 UTSW 6 122,013,241 (GRCm39) missense probably benign
R7850:Mug2 UTSW 6 122,052,170 (GRCm39) missense probably damaging 1.00
R8029:Mug2 UTSW 6 122,058,504 (GRCm39) critical splice acceptor site probably null
R8127:Mug2 UTSW 6 122,052,567 (GRCm39) missense probably benign 0.01
R8335:Mug2 UTSW 6 122,017,543 (GRCm39) missense probably benign
R8348:Mug2 UTSW 6 122,049,192 (GRCm39) nonsense probably null
R8557:Mug2 UTSW 6 122,040,660 (GRCm39) missense probably damaging 0.99
R8798:Mug2 UTSW 6 122,058,569 (GRCm39) missense probably damaging 1.00
R8823:Mug2 UTSW 6 122,040,648 (GRCm39) missense possibly damaging 0.89
R9029:Mug2 UTSW 6 122,061,328 (GRCm39) missense probably damaging 1.00
R9153:Mug2 UTSW 6 122,017,627 (GRCm39) missense possibly damaging 0.71
R9185:Mug2 UTSW 6 122,054,442 (GRCm39) missense probably benign 0.06
R9186:Mug2 UTSW 6 122,052,248 (GRCm39) missense probably damaging 0.99
R9418:Mug2 UTSW 6 122,017,700 (GRCm39) missense probably benign 0.00
R9464:Mug2 UTSW 6 122,028,690 (GRCm39) missense probably benign 0.01
R9622:Mug2 UTSW 6 122,028,751 (GRCm39) missense probably benign 0.29
Z1177:Mug2 UTSW 6 122,014,080 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTCACAGCATAACTAGTGCTGC -3'
(R):5'- ATTGAGTTCAAGCTGTTGCAAAGC -3'

Sequencing Primer
(F):5'- CAGCATAACTAGTGCTGCTGGTATG -3'
(R):5'- AAAGCCTTGCCTTTTGTCTTTTG -3'
Posted On 2017-10-10