Incidental Mutation 'R6184:BC048403'
ID488150
Institutional Source Beutler Lab
Gene Symbol BC048403
Ensembl Gene ENSMUSG00000053684
Gene NamecDNA sequence BC048403
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R6184 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location121739937-121752878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121750905 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 375 (L375P)
Ref Sequence ENSEMBL: ENSMUSP00000070834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065600] [ENSMUST00000136432]
PDB Structure
X-ray structure of a hypothetical protein from Mouse Mm.209172 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000065600
AA Change: L375P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070834
Gene: ENSMUSG00000053684
AA Change: L375P

DomainStartEndE-ValueType
Pfam:DUF2003 7 444 3.8e-252 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000136432
AA Change: L239P

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117249
Gene: ENSMUSG00000053684
AA Change: L239P

DomainStartEndE-ValueType
Pfam:DUF2003 1 309 1.1e-205 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138630
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik A G 12: 17,007,178 F106S probably benign Het
Adgrv1 A T 13: 81,433,838 F4696I probably benign Het
Ank2 T C 3: 126,962,398 I1073V probably damaging Het
Card11 A T 5: 140,898,278 D415E probably damaging Het
Clec16a G A 16: 10,572,928 probably null Het
Coro2a T C 4: 46,540,504 T472A probably benign Het
D130043K22Rik T A 13: 24,885,591 F878I probably damaging Het
D5Ertd579e G T 5: 36,629,783 D80E probably damaging Het
Ddrgk1 A T 2: 130,664,561 V2E possibly damaging Het
Disp1 T C 1: 183,086,332 H1508R probably benign Het
Dmtf1 T C 5: 9,126,656 N344S probably benign Het
Eml5 A G 12: 98,863,129 V503A possibly damaging Het
Fat1 A G 8: 44,953,392 H1060R probably benign Het
Fbxw8 C T 5: 118,113,749 R233Q probably damaging Het
Fer1l4 T C 2: 156,048,291 K238R probably damaging Het
Flg T A 3: 93,280,050 S270T probably benign Het
Gm10801 TC TCGCC 2: 98,663,806 probably benign Het
Gm3604 A T 13: 62,371,845 V32D probably damaging Het
Gnl2 T G 4: 125,054,229 probably null Het
Gpr162 A G 6: 124,861,241 S149P probably damaging Het
Il2ra T A 2: 11,647,979 probably benign Het
Kmt5b T A 19: 3,804,499 M254K probably damaging Het
Lrriq3 T C 3: 155,129,402 I258T probably benign Het
Mbnl1 T C 3: 60,615,744 L328S probably damaging Het
Mboat2 A G 12: 24,951,431 D277G possibly damaging Het
Mug2 A G 6: 122,037,046 I364V probably benign Het
Myh7 G A 14: 54,988,858 R442C probably damaging Het
Nin A G 12: 70,043,737 L968P probably damaging Het
Olfr1137 A T 2: 87,711,844 Y21N probably benign Het
Olfr355 T C 2: 36,927,392 T241A probably damaging Het
Olfr968 T G 9: 39,772,620 Y60S probably damaging Het
Per1 C T 11: 69,102,904 P403S probably damaging Het
Ppip5k2 T C 1: 97,734,005 I723V possibly damaging Het
Ptprg A G 14: 12,153,943 T555A probably benign Het
Rgsl1 C T 1: 153,827,448 M187I probably benign Het
Sec31a A G 5: 100,369,594 probably null Het
Sptbn5 C T 2: 120,059,417 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Het
Stx1b G A 7: 127,807,905 T206I possibly damaging Het
Tsc22d4 T A 5: 137,759,089 M35K probably damaging Het
Zc2hc1c A G 12: 85,296,444 K452E probably damaging Het
Zfp386 A G 12: 116,060,513 N582S possibly damaging Het
Zfp457 A G 13: 67,292,912 V437A possibly damaging Het
Zfp599 T C 9: 22,249,651 Y406C probably benign Het
Zfyve26 G A 12: 79,268,727 S1325F probably damaging Het
Other mutations in BC048403
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02164:BC048403 APN 10 121750770 missense probably damaging 1.00
IGL02598:BC048403 APN 10 121739971 utr 5 prime probably benign
IGL02747:BC048403 APN 10 121745550 missense possibly damaging 0.94
R0381:BC048403 UTSW 10 121745375 missense probably damaging 1.00
R0732:BC048403 UTSW 10 121750947 missense possibly damaging 0.55
R2383:BC048403 UTSW 10 121750649 missense possibly damaging 0.69
R4299:BC048403 UTSW 10 121745446 missense probably benign 0.01
R4760:BC048403 UTSW 10 121740007 missense probably damaging 1.00
R5595:BC048403 UTSW 10 121740147 start gained probably benign
R6487:BC048403 UTSW 10 121745541 missense probably damaging 1.00
R6977:BC048403 UTSW 10 121745466 missense probably damaging 0.98
R7094:BC048403 UTSW 10 121740193 missense possibly damaging 0.95
R7250:BC048403 UTSW 10 121745471 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GAAATACGACGCTGCCAACG -3'
(R):5'- CAGACTTGCAAACACTTTGGG -3'

Sequencing Primer
(F):5'- CTTAATTTTTGACAACCGGGGC -3'
(R):5'- CAAACACTTTGGGGTTCTTAAGGGC -3'
Posted On2017-10-10