Incidental Mutation 'R6184:Mboat2'
ID488153
Institutional Source Beutler Lab
Gene Symbol Mboat2
Ensembl Gene ENSMUSG00000020646
Gene Namemembrane bound O-acyltransferase domain containing 2
SynonymsOact2, 2810049G06Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6184 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location24830879-24964397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24951431 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 277 (D277G)
Ref Sequence ENSEMBL: ENSMUSP00000152348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078902] [ENSMUST00000110942] [ENSMUST00000221952] [ENSMUST00000222994]
Predicted Effect probably benign
Transcript: ENSMUST00000078902
AA Change: D176G

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000077937
Gene: ENSMUSG00000020646
AA Change: D176G

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
Pfam:MBOAT 97 405 8.9e-35 PFAM
transmembrane domain 410 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110942
AA Change: D309G

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106567
Gene: ENSMUSG00000020646
AA Change: D309G

DomainStartEndE-ValueType
Pfam:MBOAT 21 430 2.8e-32 PFAM
transmembrane domain 442 464 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000221952
AA Change: D277G

PolyPhen 2 Score 0.544 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000222994
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik A G 12: 17,007,178 F106S probably benign Het
Adgrv1 A T 13: 81,433,838 F4696I probably benign Het
Ank2 T C 3: 126,962,398 I1073V probably damaging Het
BC048403 T C 10: 121,750,905 L375P probably damaging Het
Card11 A T 5: 140,898,278 D415E probably damaging Het
Clec16a G A 16: 10,572,928 probably null Het
Coro2a T C 4: 46,540,504 T472A probably benign Het
D130043K22Rik T A 13: 24,885,591 F878I probably damaging Het
D5Ertd579e G T 5: 36,629,783 D80E probably damaging Het
Ddrgk1 A T 2: 130,664,561 V2E possibly damaging Het
Disp1 T C 1: 183,086,332 H1508R probably benign Het
Dmtf1 T C 5: 9,126,656 N344S probably benign Het
Eml5 A G 12: 98,863,129 V503A possibly damaging Het
Fat1 A G 8: 44,953,392 H1060R probably benign Het
Fbxw8 C T 5: 118,113,749 R233Q probably damaging Het
Fer1l4 T C 2: 156,048,291 K238R probably damaging Het
Flg T A 3: 93,280,050 S270T probably benign Het
Gm10801 TC TCGCC 2: 98,663,806 probably benign Het
Gm3604 A T 13: 62,371,845 V32D probably damaging Het
Gnl2 T G 4: 125,054,229 probably null Het
Gpr162 A G 6: 124,861,241 S149P probably damaging Het
Il2ra T A 2: 11,647,979 probably benign Het
Kmt5b T A 19: 3,804,499 M254K probably damaging Het
Lrriq3 T C 3: 155,129,402 I258T probably benign Het
Mbnl1 T C 3: 60,615,744 L328S probably damaging Het
Mug2 A G 6: 122,037,046 I364V probably benign Het
Myh7 G A 14: 54,988,858 R442C probably damaging Het
Nin A G 12: 70,043,737 L968P probably damaging Het
Olfr1137 A T 2: 87,711,844 Y21N probably benign Het
Olfr355 T C 2: 36,927,392 T241A probably damaging Het
Olfr968 T G 9: 39,772,620 Y60S probably damaging Het
Per1 C T 11: 69,102,904 P403S probably damaging Het
Ppip5k2 T C 1: 97,734,005 I723V possibly damaging Het
Ptprg A G 14: 12,153,943 T555A probably benign Het
Rgsl1 C T 1: 153,827,448 M187I probably benign Het
Sec31a A G 5: 100,369,594 probably null Het
Sptbn5 C T 2: 120,059,417 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Het
Stx1b G A 7: 127,807,905 T206I possibly damaging Het
Tsc22d4 T A 5: 137,759,089 M35K probably damaging Het
Zc2hc1c A G 12: 85,296,444 K452E probably damaging Het
Zfp386 A G 12: 116,060,513 N582S possibly damaging Het
Zfp457 A G 13: 67,292,912 V437A possibly damaging Het
Zfp599 T C 9: 22,249,651 Y406C probably benign Het
Zfyve26 G A 12: 79,268,727 S1325F probably damaging Het
Other mutations in Mboat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Mboat2 APN 12 24939354 splice site probably benign
IGL00755:Mboat2 APN 12 24957646 missense probably benign 0.20
IGL01691:Mboat2 APN 12 24954222 missense probably damaging 1.00
IGL02824:Mboat2 APN 12 24946586 missense probably benign 0.03
R1052:Mboat2 UTSW 12 24946528 missense probably damaging 1.00
R1531:Mboat2 UTSW 12 24959030 missense probably benign
R1998:Mboat2 UTSW 12 24946673 missense possibly damaging 0.58
R1999:Mboat2 UTSW 12 24946673 missense possibly damaging 0.58
R2069:Mboat2 UTSW 12 24951443 missense probably benign
R2921:Mboat2 UTSW 12 24954240 missense probably damaging 1.00
R2923:Mboat2 UTSW 12 24954240 missense probably damaging 1.00
R3113:Mboat2 UTSW 12 24882719 missense probably damaging 1.00
R4300:Mboat2 UTSW 12 24959083 missense probably benign 0.33
R5133:Mboat2 UTSW 12 24959066 missense probably benign 0.00
R5356:Mboat2 UTSW 12 24957573 missense probably benign 0.24
R6084:Mboat2 UTSW 12 24878285 missense probably damaging 1.00
R6194:Mboat2 UTSW 12 24946638 missense probably benign 0.07
R6281:Mboat2 UTSW 12 24957679 missense probably benign 0.18
R7026:Mboat2 UTSW 12 24948382 critical splice donor site probably null
R7269:Mboat2 UTSW 12 24831709 missense probably benign 0.02
R7638:Mboat2 UTSW 12 24939326 missense probably damaging 1.00
R7936:Mboat2 UTSW 12 24955393 missense probably damaging 1.00
R8416:Mboat2 UTSW 12 24934610 missense probably damaging 1.00
Z1176:Mboat2 UTSW 12 24948344 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TATACACCTCCTGGGAGAGC -3'
(R):5'- AAAGTTTGCAGCCTACTGTGG -3'

Sequencing Primer
(F):5'- ACAAGGTCCAGGTTCAGTTC -3'
(R):5'- TGCAGCCTACTGTGGTCAAC -3'
Posted On2017-10-10