Incidental Mutation 'R6184:D130043K22Rik'
ID 488159
Institutional Source Beutler Lab
Gene Symbol D130043K22Rik
Ensembl Gene ENSMUSG00000006711
Gene Name RIKEN cDNA D130043K22 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6184 (G1)
Quality Score 140.008
Status Not validated
Chromosome 13
Chromosomal Location 24845135-24901270 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 24885591 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 878 (F878I)
Ref Sequence ENSEMBL: ENSMUSP00000006893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006893] [ENSMUST00000141572]
AlphaFold Q5SZV5
Predicted Effect probably damaging
Transcript: ENSMUST00000006893
AA Change: F878I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006893
Gene: ENSMUSG00000006711
AA Change: F878I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:MANEC 23 102 3e-44 BLAST
low complexity region 236 270 N/A INTRINSIC
FN3 332 427 3.43e1 SMART
PKD 345 436 3.96e0 SMART
FN3 435 521 3.08e1 SMART
PKD 444 533 7.12e-10 SMART
PKD 539 629 1.46e-6 SMART
PKD 630 723 6.75e-11 SMART
FN3 634 711 5.1e1 SMART
FN3 728 808 9.15e1 SMART
PKD 729 820 4.38e-10 SMART
transmembrane domain 965 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141572
SMART Domains Protein: ENSMUSP00000116004
Gene: ENSMUSG00000006711

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:MANEC 23 102 2e-44 BLAST
low complexity region 236 270 N/A INTRINSIC
FN3 332 427 3.43e1 SMART
PKD 345 436 3.96e0 SMART
FN3 435 521 3.08e1 SMART
PKD 444 533 7.12e-10 SMART
PKD 539 629 1.46e-6 SMART
PKD 630 723 6.75e-11 SMART
FN3 634 711 5.1e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169411
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein that contains a large extracellular domain with multiple polycystic kidney disease (PKD) domains. The encoded protein may play a role in the development of the cerebral cortex by regulating neuronal migration and cell adhesion. Single nucleotide polymorphisms in a similar gene in human are associated with dyslexia. Alternatively spliced transcript variants have been identifed. [provided by RefSeq, May 2015]
PHENOTYPE: Homozygous knockout results in a mild behavioral phenotype: increased prepulse inhibition in males under certain conditions and decreased anxiety-related response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik A G 12: 17,007,178 F106S probably benign Het
Adgrv1 A T 13: 81,433,838 F4696I probably benign Het
Ank2 T C 3: 126,962,398 I1073V probably damaging Het
BC048403 T C 10: 121,750,905 L375P probably damaging Het
Card11 A T 5: 140,898,278 D415E probably damaging Het
Clec16a G A 16: 10,572,928 probably null Het
Coro2a T C 4: 46,540,504 T472A probably benign Het
D5Ertd579e G T 5: 36,629,783 D80E probably damaging Het
Ddrgk1 A T 2: 130,664,561 V2E possibly damaging Het
Disp1 T C 1: 183,086,332 H1508R probably benign Het
Dmtf1 T C 5: 9,126,656 N344S probably benign Het
Eml5 A G 12: 98,863,129 V503A possibly damaging Het
Fat1 A G 8: 44,953,392 H1060R probably benign Het
Fbxw8 C T 5: 118,113,749 R233Q probably damaging Het
Fer1l4 T C 2: 156,048,291 K238R probably damaging Het
Flg T A 3: 93,280,050 S270T probably benign Het
Gm10801 TC TCGCC 2: 98,663,806 probably benign Het
Gm3604 A T 13: 62,371,845 V32D probably damaging Het
Gnl2 T G 4: 125,054,229 probably null Het
Gpr162 A G 6: 124,861,241 S149P probably damaging Het
Il2ra T A 2: 11,647,979 probably benign Het
Kmt5b T A 19: 3,804,499 M254K probably damaging Het
Lrriq3 T C 3: 155,129,402 I258T probably benign Het
Mbnl1 T C 3: 60,615,744 L328S probably damaging Het
Mboat2 A G 12: 24,951,431 D277G possibly damaging Het
Mug2 A G 6: 122,037,046 I364V probably benign Het
Myh7 G A 14: 54,988,858 R442C probably damaging Het
Nin A G 12: 70,043,737 L968P probably damaging Het
Olfr1137 A T 2: 87,711,844 Y21N probably benign Het
Olfr355 T C 2: 36,927,392 T241A probably damaging Het
Olfr968 T G 9: 39,772,620 Y60S probably damaging Het
Per1 C T 11: 69,102,904 P403S probably damaging Het
Ppip5k2 T C 1: 97,734,005 I723V possibly damaging Het
Ptprg A G 14: 12,153,943 T555A probably benign Het
Rgsl1 C T 1: 153,827,448 M187I probably benign Het
Sec31a A G 5: 100,369,594 probably null Het
Sptbn5 C T 2: 120,059,417 probably benign Het
Sry C G Y: 2,662,975 Q228H unknown Het
Stx1b G A 7: 127,807,905 T206I possibly damaging Het
Tsc22d4 T A 5: 137,759,089 M35K probably damaging Het
Zc2hc1c A G 12: 85,296,444 K452E probably damaging Het
Zfp386 A G 12: 116,060,513 N582S possibly damaging Het
Zfp457 A G 13: 67,292,912 V437A possibly damaging Het
Zfp599 T C 9: 22,249,651 Y406C probably benign Het
Zfyve26 G A 12: 79,268,727 S1325F probably damaging Het
Other mutations in D130043K22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:D130043K22Rik APN 13 24867174 missense probably damaging 1.00
IGL01114:D130043K22Rik APN 13 24857156 missense probably damaging 0.99
IGL01412:D130043K22Rik APN 13 24887860 missense probably damaging 1.00
IGL01542:D130043K22Rik APN 13 24876037 splice site probably null
IGL01615:D130043K22Rik APN 13 24899796 missense probably damaging 1.00
IGL01705:D130043K22Rik APN 13 24857941 missense probably benign 0.00
IGL02220:D130043K22Rik APN 13 24883755 missense possibly damaging 0.95
IGL02229:D130043K22Rik APN 13 24875924 missense probably damaging 1.00
IGL02576:D130043K22Rik APN 13 24856870 missense possibly damaging 0.74
IGL03038:D130043K22Rik APN 13 24879619 missense probably damaging 1.00
IGL03117:D130043K22Rik APN 13 24889842 missense probably damaging 1.00
IGL03014:D130043K22Rik UTSW 13 24858092 missense possibly damaging 0.88
R0019:D130043K22Rik UTSW 13 24880812 missense probably damaging 1.00
R0019:D130043K22Rik UTSW 13 24880812 missense probably damaging 1.00
R0020:D130043K22Rik UTSW 13 24854492 utr 5 prime probably benign
R0172:D130043K22Rik UTSW 13 24872406 missense probably benign 0.16
R0276:D130043K22Rik UTSW 13 24858045 missense possibly damaging 0.92
R0304:D130043K22Rik UTSW 13 24864815 missense probably benign 0.07
R0335:D130043K22Rik UTSW 13 24887877 missense probably damaging 0.98
R0744:D130043K22Rik UTSW 13 24863580 splice site probably benign
R0833:D130043K22Rik UTSW 13 24863580 splice site probably benign
R0836:D130043K22Rik UTSW 13 24863580 splice site probably benign
R1270:D130043K22Rik UTSW 13 24857338 missense probably benign 0.00
R1433:D130043K22Rik UTSW 13 24871341 missense probably damaging 1.00
R1682:D130043K22Rik UTSW 13 24882556 missense probably damaging 1.00
R1772:D130043K22Rik UTSW 13 24875999 missense probably damaging 1.00
R1773:D130043K22Rik UTSW 13 24882602 missense possibly damaging 0.80
R1800:D130043K22Rik UTSW 13 24883894 missense probably damaging 1.00
R1956:D130043K22Rik UTSW 13 24885595 missense probably damaging 1.00
R2255:D130043K22Rik UTSW 13 24856911 missense probably damaging 1.00
R2445:D130043K22Rik UTSW 13 24857036 missense probably benign 0.04
R2568:D130043K22Rik UTSW 13 24883891 missense probably damaging 0.97
R4160:D130043K22Rik UTSW 13 24862696 missense probably benign 0.02
R4494:D130043K22Rik UTSW 13 24871356 missense probably benign 0.16
R4732:D130043K22Rik UTSW 13 24899665 missense probably damaging 1.00
R4733:D130043K22Rik UTSW 13 24899665 missense probably damaging 1.00
R4782:D130043K22Rik UTSW 13 24878040 missense probably damaging 1.00
R4799:D130043K22Rik UTSW 13 24878040 missense probably damaging 1.00
R4864:D130043K22Rik UTSW 13 24863612 missense probably damaging 1.00
R5155:D130043K22Rik UTSW 13 24872290 missense probably damaging 1.00
R5240:D130043K22Rik UTSW 13 24877977 missense probably damaging 1.00
R5383:D130043K22Rik UTSW 13 24857414 missense probably benign 0.02
R5493:D130043K22Rik UTSW 13 24863603 missense probably damaging 1.00
R6305:D130043K22Rik UTSW 13 24885685 missense probably damaging 1.00
R6436:D130043K22Rik UTSW 13 24877935 missense probably damaging 1.00
R6980:D130043K22Rik UTSW 13 24864781 missense probably damaging 0.98
R7038:D130043K22Rik UTSW 13 24893408 missense probably damaging 1.00
R7085:D130043K22Rik UTSW 13 24872302 missense possibly damaging 0.95
R7147:D130043K22Rik UTSW 13 24882563 missense probably benign 0.31
R7384:D130043K22Rik UTSW 13 24882605 missense probably damaging 1.00
R7398:D130043K22Rik UTSW 13 24893377 missense probably damaging 0.97
R7584:D130043K22Rik UTSW 13 24872370 missense probably damaging 1.00
R7585:D130043K22Rik UTSW 13 24885585 missense probably benign 0.01
R7588:D130043K22Rik UTSW 13 24887893 missense probably damaging 0.99
R7610:D130043K22Rik UTSW 13 24876002 missense probably benign 0.30
R7903:D130043K22Rik UTSW 13 24876012 missense probably damaging 0.98
R7966:D130043K22Rik UTSW 13 24893423 missense probably damaging 1.00
R8014:D130043K22Rik UTSW 13 24856702 missense probably damaging 1.00
R8374:D130043K22Rik UTSW 13 24857979 missense probably benign 0.07
R8543:D130043K22Rik UTSW 13 24889869 missense probably benign 0.08
R8775:D130043K22Rik UTSW 13 24856999 nonsense probably null
R8775-TAIL:D130043K22Rik UTSW 13 24856999 nonsense probably null
R8806:D130043K22Rik UTSW 13 24899635 missense probably benign 0.11
R8916:D130043K22Rik UTSW 13 24872271 missense probably benign
R9209:D130043K22Rik UTSW 13 24857107 missense possibly damaging 0.96
R9524:D130043K22Rik UTSW 13 24887893 missense possibly damaging 0.89
Z1177:D130043K22Rik UTSW 13 24856709 missense probably damaging 1.00
Z1177:D130043K22Rik UTSW 13 24856834 missense probably benign 0.39
Z1177:D130043K22Rik UTSW 13 24872248 missense possibly damaging 0.79
Z1177:D130043K22Rik UTSW 13 24880847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCTTTGACATCCACATCTACAC -3'
(R):5'- CCATGGTTAGCATGTCTGACTG -3'

Sequencing Primer
(F):5'- CCCAAACAAACAAGTTATACAAGTC -3'
(R):5'- AGCATGTCTGACTGTTTTATTATGG -3'
Posted On 2017-10-10