Incidental Mutation 'R0525:Sned1'
ID48817
Institutional Source Beutler Lab
Gene Symbol Sned1
Ensembl Gene ENSMUSG00000047793
Gene Namesushi, nidogen and EGF-like domains 1
Synonyms6720455I24Rik, D430044C15Rik, Snep
MMRRC Submission 038718-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R0525 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location93235841-93301065 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to A at 93271974 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000050832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062202]
Predicted Effect probably null
Transcript: ENSMUST00000062202
SMART Domains Protein: ENSMUSP00000050832
Gene: ENSMUSG00000047793

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
NIDO 103 260 2.98e-54 SMART
EGF 271 309 3.79e-6 SMART
EGF_CA 311 347 2.42e-13 SMART
EGF 352 385 1.02e-6 SMART
EGF_CA 387 423 1.91e-11 SMART
EGF 432 465 2.96e-8 SMART
EGF 471 500 6.02e0 SMART
EGF 544 577 3.54e-6 SMART
EGF 583 616 6.06e-5 SMART
EGF_CA 619 655 2.33e-6 SMART
EGF 660 693 1.77e-6 SMART
CCP 698 751 2.5e-11 SMART
EGF_CA 753 789 1.66e-11 SMART
EGF_CA 791 827 1.38e-8 SMART
EGF_CA 829 865 1.92e-7 SMART
EGF 870 903 2.35e-2 SMART
FN3 906 991 1.7e-4 SMART
FN3 1005 1084 1.38e-4 SMART
FN3 1104 1185 1.6e-9 SMART
EGF 1309 1342 6.16e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185062
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933440M02Rik T A 7: 125,331,499 noncoding transcript Het
A930002H24Rik A G 17: 63,863,647 W49R unknown Het
Abca13 G A 11: 9,293,371 V1745M probably damaging Het
Abca16 T G 7: 120,465,810 Y563* probably null Het
Acot12 C T 13: 91,760,067 probably benign Het
Alms1 G A 6: 85,587,760 A39T unknown Het
Arid5b T C 10: 68,097,846 D742G possibly damaging Het
Atp1a4 G A 1: 172,239,688 probably benign Het
AU021092 T A 16: 5,217,861 E145V possibly damaging Het
Calr4 A T 4: 109,242,264 probably benign Het
Clip4 T A 17: 71,799,098 probably null Het
Cnpy4 A T 5: 138,192,616 H180L probably benign Het
Cyp2j9 T C 4: 96,579,565 probably null Het
Dgkq A G 5: 108,654,615 S406P probably damaging Het
Dhx8 G A 11: 101,763,928 C1014Y probably damaging Het
Dnah3 T C 7: 119,928,754 Y3824C probably damaging Het
Donson A T 16: 91,686,245 H69Q probably damaging Het
Dppa3 A G 6: 122,629,980 E143G probably damaging Het
Drg1 A G 11: 3,262,545 F96L probably damaging Het
Dvl1 A C 4: 155,855,595 T395P probably damaging Het
Eftud2 A T 11: 102,839,253 V897D probably damaging Het
Enpp6 A G 8: 47,082,443 N341S possibly damaging Het
F11 A G 8: 45,253,049 F100L probably benign Het
Fas T C 19: 34,319,327 Y189H probably damaging Het
Galnt14 G T 17: 73,545,081 S114R probably damaging Het
Gfpt2 A G 11: 49,829,775 I528V probably benign Het
Glt6d1 A G 2: 25,794,268 V242A possibly damaging Het
Grm1 A T 10: 10,719,209 probably benign Het
Gskip G A 12: 105,698,965 A88T probably damaging Het
Gtpbp1 A G 15: 79,713,447 I348V probably benign Het
Hnrnpul1 C A 7: 25,740,883 R316L possibly damaging Het
Il34 T C 8: 110,748,283 E121G probably damaging Het
Lrr1 T C 12: 69,168,911 L19P probably damaging Het
Mat2b A G 11: 40,682,669 probably benign Het
Mettl21e T C 1: 44,206,382 K235E probably damaging Het
Mir124-2hg T A 3: 17,785,529 E126V possibly damaging Het
Myh15 A G 16: 49,132,051 K828R probably benign Het
Myom3 A G 4: 135,764,926 D127G possibly damaging Het
Nek5 C A 8: 22,079,077 probably benign Het
Nudt7 A T 8: 114,151,652 probably null Het
Olfr1056 C T 2: 86,356,275 V36I probably benign Het
Olfr1118 A T 2: 87,309,349 T187S probably benign Het
Olfr1200 G A 2: 88,767,314 Q334* probably null Het
Olfr350 T C 2: 36,850,190 L48P probably damaging Het
Olfr961 T G 9: 39,647,471 C248W probably damaging Het
Phyhd1 A G 2: 30,281,028 H241R probably damaging Het
Pmch T C 10: 88,091,400 probably benign Het
Ror1 A G 4: 100,441,520 S697G probably damaging Het
Rslcan18 A G 13: 67,112,258 V25A probably benign Het
Sema6b T C 17: 56,126,630 H426R probably damaging Het
Serpina3g T C 12: 104,238,339 F9S probably damaging Het
Serpinb12 T A 1: 106,946,702 H52Q probably benign Het
Sh3gl1 T C 17: 56,017,873 K294R probably benign Het
Sidt1 G T 16: 44,259,446 T615K possibly damaging Het
Slc16a4 A C 3: 107,297,939 probably benign Het
Sp2 A T 11: 96,956,098 probably benign Het
Steap1 T A 5: 5,742,903 I3F possibly damaging Het
Stxbp5l A T 16: 37,129,797 probably null Het
Tbc1d9 G T 8: 83,268,985 V968F probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Triobp T C 15: 78,973,898 L1233P possibly damaging Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Trpc4ap A G 2: 155,640,478 F531L possibly damaging Het
Ugt1a10 C T 1: 88,218,249 P473L probably damaging Het
Vmn1r86 T C 7: 13,102,161 K213E probably benign Het
Vps8 G A 16: 21,540,109 probably null Het
Wnk1 A T 6: 119,926,564 S2563T probably damaging Het
Yrdc C G 4: 124,851,766 R3G probably damaging Het
Zfp287 A T 11: 62,715,244 V279E probably benign Het
Other mutations in Sned1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Sned1 APN 1 93274169 splice site probably benign
IGL00955:Sned1 APN 1 93274403 missense probably damaging 1.00
IGL01367:Sned1 APN 1 93283214 missense probably benign 0.32
IGL02116:Sned1 APN 1 93281725 nonsense probably null
IGL02195:Sned1 APN 1 93274160 missense probably benign 0.03
IGL02390:Sned1 APN 1 93261664 missense probably benign
IGL02423:Sned1 APN 1 93283600 missense probably benign
IGL02451:Sned1 APN 1 93236208 splice site probably benign
IGL02567:Sned1 APN 1 93274347 missense probably damaging 0.96
IGL03184:Sned1 APN 1 93274668 missense probably benign 0.01
IGL03328:Sned1 APN 1 93289367 missense probably benign
R0257:Sned1 UTSW 1 93265097 missense possibly damaging 0.75
R0372:Sned1 UTSW 1 93285951 splice site probably benign
R0727:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R0759:Sned1 UTSW 1 93272564 missense probably damaging 1.00
R0965:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R0968:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R0969:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1006:Sned1 UTSW 1 93256392 missense probably damaging 1.00
R1068:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1069:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1070:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1112:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1113:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1114:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1115:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1118:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1119:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1144:Sned1 UTSW 1 93280576 missense probably damaging 0.98
R1228:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1230:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1231:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1313:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1313:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1340:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1382:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1383:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1394:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1395:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1397:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1414:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1430:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1432:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1473:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1503:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1563:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1565:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1689:Sned1 UTSW 1 93283372 missense probably damaging 0.99
R1695:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1734:Sned1 UTSW 1 93259768 missense probably damaging 1.00
R1764:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1767:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1896:Sned1 UTSW 1 93265047 missense probably benign 0.16
R1916:Sned1 UTSW 1 93274162 missense probably null 1.00
R1945:Sned1 UTSW 1 93271238 missense probably benign 0.01
R1972:Sned1 UTSW 1 93265073 missense probably damaging 1.00
R1973:Sned1 UTSW 1 93265073 missense probably damaging 1.00
R2143:Sned1 UTSW 1 93271684 missense probably damaging 1.00
R2144:Sned1 UTSW 1 93271684 missense probably damaging 1.00
R2145:Sned1 UTSW 1 93271684 missense probably damaging 1.00
R2153:Sned1 UTSW 1 93274657 missense probably benign 0.01
R2273:Sned1 UTSW 1 93281642 splice site probably null
R2274:Sned1 UTSW 1 93281642 splice site probably null
R2275:Sned1 UTSW 1 93281642 splice site probably null
R2340:Sned1 UTSW 1 93256452 missense probably damaging 0.98
R3237:Sned1 UTSW 1 93259003 missense probably benign 0.21
R3747:Sned1 UTSW 1 93261751 missense probably damaging 1.00
R3879:Sned1 UTSW 1 93265030 splice site probably benign
R4281:Sned1 UTSW 1 93285855 nonsense probably null
R4282:Sned1 UTSW 1 93285855 nonsense probably null
R4356:Sned1 UTSW 1 93265391 splice site probably null
R4358:Sned1 UTSW 1 93274659 missense probably benign 0.01
R4677:Sned1 UTSW 1 93296297 unclassified probably benign
R5291:Sned1 UTSW 1 93295724 missense possibly damaging 0.80
R5340:Sned1 UTSW 1 93282757 missense probably benign 0.09
R5542:Sned1 UTSW 1 93271602 missense probably benign
R5582:Sned1 UTSW 1 93282361 missense probably damaging 1.00
R5874:Sned1 UTSW 1 93265345 missense probably damaging 1.00
R6159:Sned1 UTSW 1 93282937 missense probably benign 0.00
R6175:Sned1 UTSW 1 93275474 splice site probably null
R6445:Sned1 UTSW 1 93283596 missense possibly damaging 0.89
R6631:Sned1 UTSW 1 93281652 missense probably damaging 1.00
R7018:Sned1 UTSW 1 93284421 missense probably damaging 1.00
R7035:Sned1 UTSW 1 93262130 missense probably damaging 1.00
R7047:Sned1 UTSW 1 93285818 missense possibly damaging 0.51
R7347:Sned1 UTSW 1 93281736 missense probably damaging 1.00
R7427:Sned1 UTSW 1 93289358 missense probably benign 0.11
R7581:Sned1 UTSW 1 93256545 missense probably benign 0.00
R7679:Sned1 UTSW 1 93236038 missense unknown
X0025:Sned1 UTSW 1 93261687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAATGACTGTGACTGCCGGAAC -3'
(R):5'- TGCAACAAGGTAACTTTGACCCCTG -3'

Sequencing Primer
(F):5'- CCCTGGACATAATTAGTAGGGTCAC -3'
(R):5'- CTAACGTGTAGAGTAGCAAATGCATC -3'
Posted On2013-06-12