Incidental Mutation 'R6174:Ptpru'
ID488184
Institutional Source Beutler Lab
Gene Symbol Ptpru
Ensembl Gene ENSMUSG00000028909
Gene Nameprotein tyrosine phosphatase, receptor type, U
SynonymsPtprl, RPTPlambda
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6174 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location131768457-131838288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131785754 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 881 (I881V)
Ref Sequence ENSEMBL: ENSMUSP00000095472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030741] [ENSMUST00000097860] [ENSMUST00000105987]
Predicted Effect probably benign
Transcript: ENSMUST00000030741
SMART Domains Protein: ENSMUSP00000030741
Gene: ENSMUSG00000028909

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 22 188 5.58e-68 SMART
IG 195 283 4.93e-3 SMART
FN3 285 368 3.79e-2 SMART
FN3 384 472 2.5e-2 SMART
FN3 488 576 3.62e-8 SMART
low complexity region 627 641 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
transmembrane domain 747 769 N/A INTRINSIC
PTPc 893 1146 5.95e-102 SMART
PTPc 1175 1441 3.67e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097860
AA Change: I881V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095472
Gene: ENSMUSG00000028909
AA Change: I881V

DomainStartEndE-ValueType
Pfam:MAM 1 116 4.1e-30 PFAM
IG 123 211 4.93e-3 SMART
FN3 213 296 3.79e-2 SMART
FN3 312 400 2.5e-2 SMART
FN3 416 504 3.62e-8 SMART
low complexity region 555 569 N/A INTRINSIC
low complexity region 595 605 N/A INTRINSIC
transmembrane domain 675 697 N/A INTRINSIC
Blast:PTPc 736 878 3e-49 BLAST
SCOP:d1jlna_ 790 886 9e-19 SMART
PDB:2C7S|A 797 878 7e-22 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000105987
SMART Domains Protein: ENSMUSP00000101607
Gene: ENSMUSG00000028909

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 22 188 5.58e-68 SMART
IG 195 283 4.93e-3 SMART
FN3 285 368 3.79e-2 SMART
FN3 384 472 2.5e-2 SMART
FN3 488 576 3.62e-8 SMART
low complexity region 627 641 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
PTPc 883 1136 5.95e-102 SMART
PTPc 1165 1431 3.67e-93 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127633
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. This PTP was thought to play roles in cell-cell recognition and adhesion. Studies of the similar gene in mice suggested the role of this PTP in early neural development. The expression of this gene was reported to be regulated by phorbol myristate acetate (PMA) or calcium ionophore in Jurkat T lymphoma cells. Alternatively spliced transcript variants have been reported. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T A 6: 91,942,536 D725E probably damaging Het
9530053A07Rik A G 7: 28,139,959 Y399C probably damaging Het
Bco1 T A 8: 117,113,534 Y264N probably damaging Het
Cd109 G A 9: 78,665,546 probably null Het
Cdc45 T C 16: 18,794,704 probably null Het
Ckap5 A G 2: 91,568,219 E578G probably benign Het
Cracr2b T A 7: 141,464,836 L193Q probably damaging Het
D11Wsu47e C A 11: 113,688,975 H399N possibly damaging Het
Dmxl2 G A 9: 54,393,727 L2367F probably damaging Het
Dopey2 T G 16: 93,766,222 D871E probably damaging Het
Emc1 T C 4: 139,366,531 Y651H probably benign Het
Enox1 T C 14: 77,508,187 S41P possibly damaging Het
Foxa1 A G 12: 57,542,900 L178P probably damaging Het
Gm10639 T A 9: 78,304,455 Y166* probably null Het
Grm7 T A 6: 111,246,297 Y433N probably benign Het
Gtf3c2 G A 5: 31,158,211 R813C probably damaging Het
Hacd3 T C 9: 65,005,627 E117G probably damaging Het
Hist1h4i T A 13: 22,041,077 T83S probably benign Het
Hmcn1 G A 1: 150,646,784 T3455M probably benign Het
Itga6 A G 2: 71,833,709 I61V possibly damaging Het
Jaml T C 9: 45,088,773 L81P probably damaging Het
Loxhd1 T C 18: 77,412,178 F782S probably damaging Het
Lrp1b T C 2: 41,449,263 H742R probably benign Het
Macrod2 G T 2: 140,400,975 M1I probably null Het
Mcf2l G A 8: 13,013,849 W1020* probably null Het
Msgn1 A G 12: 11,208,923 L9P probably damaging Het
Ngdn C A 14: 55,022,099 S202R probably benign Het
Notch1 C T 2: 26,485,442 G50R possibly damaging Het
Olfr1162 A T 2: 88,050,302 C107* probably null Het
Olfr310 A T 7: 86,268,801 D329E probably benign Het
Olfr43 A T 11: 74,206,640 I192N probably damaging Het
Olfr715b A T 7: 107,106,507 M118K probably damaging Het
Osbpl10 A G 9: 115,109,487 S211G probably benign Het
Pabpc6 G A 17: 9,668,155 A489V probably benign Het
Pcdhb13 A T 18: 37,443,421 D284V possibly damaging Het
Pde6c T C 19: 38,140,229 S214P possibly damaging Het
Pofut1 C T 2: 153,259,616 H192Y probably damaging Het
Pou3f2 T C 4: 22,486,960 D391G possibly damaging Het
Prc1 G A 7: 80,304,796 S165N probably benign Het
Prex1 A G 2: 166,572,963 V304A probably benign Het
Radil A G 5: 142,487,115 S847P probably benign Het
Rimklb A G 6: 122,456,412 S317P probably damaging Het
Sdhc A T 1: 171,138,702 L78* probably null Het
Skint6 T A 4: 112,839,313 I1042F possibly damaging Het
Slc1a6 T A 10: 78,801,907 D422E probably damaging Het
Slc29a1 A T 17: 45,589,928 H71Q probably damaging Het
Slfn14 A T 11: 83,276,603 D695E probably damaging Het
Spg11 A T 2: 122,086,805 probably null Het
Srgap2 A G 1: 131,289,616 V986A probably benign Het
Stab1 A T 14: 31,162,519 C172* probably null Het
Tigd4 A G 3: 84,595,267 H497R probably benign Het
Ubn2 G A 6: 38,461,536 G60D probably damaging Het
Uckl1 C T 2: 181,573,073 probably null Het
Vmn2r24 A T 6: 123,816,277 K854N probably benign Het
Vps13d G A 4: 144,975,193 Q3193* probably null Het
Wdr26 G A 1: 181,191,868 L315F probably damaging Het
Zc3h8 C A 2: 128,943,855 E24* probably null Het
Zfp39 A G 11: 58,891,387 V183A probably benign Het
Zfp608 C A 18: 54,988,544 probably benign Het
Other mutations in Ptpru
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Ptpru APN 4 131808235 missense probably benign 0.00
IGL00966:Ptpru APN 4 131772616 missense probably damaging 1.00
IGL01451:Ptpru APN 4 131769492 utr 3 prime probably benign
IGL01453:Ptpru APN 4 131769492 utr 3 prime probably benign
IGL01606:Ptpru APN 4 131808481 missense possibly damaging 0.69
IGL02451:Ptpru APN 4 131776775 splice site probably benign
IGL03135:Ptpru APN 4 131818800 missense probably damaging 0.97
IGL03366:Ptpru APN 4 131779867 missense probably damaging 1.00
PIT4366001:Ptpru UTSW 4 131799712 missense probably benign 0.03
PIT4576001:Ptpru UTSW 4 131802544 nonsense probably null
R0299:Ptpru UTSW 4 131803387 nonsense probably null
R0458:Ptpru UTSW 4 131799675 missense possibly damaging 0.49
R0502:Ptpru UTSW 4 131793643 missense probably benign 0.02
R0503:Ptpru UTSW 4 131793643 missense probably benign 0.02
R0619:Ptpru UTSW 4 131820887 missense possibly damaging 0.91
R0639:Ptpru UTSW 4 131771179 missense possibly damaging 0.49
R0843:Ptpru UTSW 4 131797948 missense probably benign 0.10
R1065:Ptpru UTSW 4 131808340 missense possibly damaging 0.49
R1170:Ptpru UTSW 4 131808527 splice site probably benign
R1382:Ptpru UTSW 4 131808229 missense probably damaging 0.98
R1442:Ptpru UTSW 4 131808269 missense probably benign 0.00
R1538:Ptpru UTSW 4 131774351 missense probably damaging 0.99
R1624:Ptpru UTSW 4 131772550 missense probably damaging 1.00
R1688:Ptpru UTSW 4 131787345 missense probably benign 0.01
R1699:Ptpru UTSW 4 131779050 missense probably damaging 1.00
R1740:Ptpru UTSW 4 131793678 splice site probably null
R1874:Ptpru UTSW 4 131769755 missense probably benign
R1959:Ptpru UTSW 4 131803477 missense probably damaging 1.00
R2051:Ptpru UTSW 4 131819087 missense possibly damaging 0.80
R2200:Ptpru UTSW 4 131820813 missense probably damaging 1.00
R2281:Ptpru UTSW 4 131808499 missense probably damaging 1.00
R2304:Ptpru UTSW 4 131772568 missense probably damaging 1.00
R2411:Ptpru UTSW 4 131771469 missense probably damaging 1.00
R2845:Ptpru UTSW 4 131819661 missense probably benign 0.00
R3767:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3768:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3769:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3770:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3937:Ptpru UTSW 4 131774304 missense probably damaging 0.99
R4079:Ptpru UTSW 4 131798710 critical splice donor site probably null
R4110:Ptpru UTSW 4 131819037 missense probably damaging 1.00
R4170:Ptpru UTSW 4 131776348 missense probably damaging 1.00
R4716:Ptpru UTSW 4 131820968 missense probably benign
R4751:Ptpru UTSW 4 131802586 missense probably damaging 0.97
R4766:Ptpru UTSW 4 131820964 missense probably damaging 1.00
R4825:Ptpru UTSW 4 131799603 missense probably benign
R4900:Ptpru UTSW 4 131788382 missense probably damaging 0.99
R4998:Ptpru UTSW 4 131776885 missense probably damaging 1.00
R5279:Ptpru UTSW 4 131820023 missense possibly damaging 0.62
R5464:Ptpru UTSW 4 131772557 missense probably damaging 1.00
R5625:Ptpru UTSW 4 131803380 missense probably null 1.00
R5667:Ptpru UTSW 4 131820190 missense possibly damaging 0.94
R5671:Ptpru UTSW 4 131820190 missense possibly damaging 0.94
R5735:Ptpru UTSW 4 131838090 missense probably benign 0.01
R5802:Ptpru UTSW 4 131788377 missense possibly damaging 0.84
R5809:Ptpru UTSW 4 131785756 missense probably benign 0.34
R5953:Ptpru UTSW 4 131776837 missense probably damaging 1.00
R5973:Ptpru UTSW 4 131818925 missense probably benign 0.00
R6029:Ptpru UTSW 4 131771293 missense probably damaging 1.00
R6072:Ptpru UTSW 4 131776228 missense probably damaging 0.99
R6089:Ptpru UTSW 4 131772630 missense possibly damaging 0.94
R6177:Ptpru UTSW 4 131793525 missense probably benign 0.00
R6367:Ptpru UTSW 4 131774352 missense probably benign 0.18
R6682:Ptpru UTSW 4 131820782 missense probably benign
R6950:Ptpru UTSW 4 131776352 missense probably damaging 0.99
R7159:Ptpru UTSW 4 131819540 missense probably damaging 1.00
R7736:Ptpru UTSW 4 131788382 missense probably damaging 1.00
R7960:Ptpru UTSW 4 131788509 missense probably benign 0.01
R8094:Ptpru UTSW 4 131793592 missense possibly damaging 0.88
R8262:Ptpru UTSW 4 131794963 nonsense probably null
R8276:Ptpru UTSW 4 131779173 missense probably damaging 1.00
R8377:Ptpru UTSW 4 131808335 missense probably damaging 1.00
X0024:Ptpru UTSW 4 131771190 missense probably benign 0.15
Z1177:Ptpru UTSW 4 131799706 missense probably benign 0.00
Z1177:Ptpru UTSW 4 131808262 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCTACTTTTGTGGAGAGAGC -3'
(R):5'- ATAGGGGTTCCACCTGGTTG -3'

Sequencing Primer
(F):5'- CTGGCAGGCTGCTGGAATG -3'
(R):5'- GTTTCTCTCGGGGCCCTG -3'
Posted On2017-10-10