Incidental Mutation 'R6174:Emc1'
ID488185
Institutional Source Beutler Lab
Gene Symbol Emc1
Ensembl Gene ENSMUSG00000078517
Gene NameER membrane protein complex subunit 1
SynonymsC230096C10Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R6174 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location139352587-139378730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139366531 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 651 (Y651H)
Ref Sequence ENSEMBL: ENSMUSP00000080888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042096] [ENSMUST00000082262] [ENSMUST00000147999] [ENSMUST00000155700] [ENSMUST00000179784]
Predicted Effect probably benign
Transcript: ENSMUST00000042096
AA Change: Y648H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000049034
Gene: ENSMUSG00000078517
AA Change: Y648H

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 787 993 1.1e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082262
AA Change: Y651H

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000080888
Gene: ENSMUSG00000078517
AA Change: Y651H

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 4.7e-10 PFAM
Pfam:DUF1620 791 996 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155700
Predicted Effect probably benign
Transcript: ENSMUST00000179784
AA Change: Y651H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137103
Gene: ENSMUSG00000078517
AA Change: Y651H

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 790 996 1.1e-66 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I transmembrane protein, which is a subunit of the endoplasmic reticulum membrane protein complex (EMC). Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T A 6: 91,942,536 D725E probably damaging Het
9530053A07Rik A G 7: 28,139,959 Y399C probably damaging Het
Bco1 T A 8: 117,113,534 Y264N probably damaging Het
Cd109 G A 9: 78,665,546 probably null Het
Cdc45 T C 16: 18,794,704 probably null Het
Ckap5 A G 2: 91,568,219 E578G probably benign Het
Cracr2b T A 7: 141,464,836 L193Q probably damaging Het
D11Wsu47e C A 11: 113,688,975 H399N possibly damaging Het
Dmxl2 G A 9: 54,393,727 L2367F probably damaging Het
Dopey2 T G 16: 93,766,222 D871E probably damaging Het
Enox1 T C 14: 77,508,187 S41P possibly damaging Het
Foxa1 A G 12: 57,542,900 L178P probably damaging Het
Gm10639 T A 9: 78,304,455 Y166* probably null Het
Grm7 T A 6: 111,246,297 Y433N probably benign Het
Gtf3c2 G A 5: 31,158,211 R813C probably damaging Het
Hacd3 T C 9: 65,005,627 E117G probably damaging Het
Hist1h4i T A 13: 22,041,077 T83S probably benign Het
Hmcn1 G A 1: 150,646,784 T3455M probably benign Het
Itga6 A G 2: 71,833,709 I61V possibly damaging Het
Jaml T C 9: 45,088,773 L81P probably damaging Het
Loxhd1 T C 18: 77,412,178 F782S probably damaging Het
Lrp1b T C 2: 41,449,263 H742R probably benign Het
Macrod2 G T 2: 140,400,975 M1I probably null Het
Mcf2l G A 8: 13,013,849 W1020* probably null Het
Msgn1 A G 12: 11,208,923 L9P probably damaging Het
Ngdn C A 14: 55,022,099 S202R probably benign Het
Notch1 C T 2: 26,485,442 G50R possibly damaging Het
Olfr1162 A T 2: 88,050,302 C107* probably null Het
Olfr310 A T 7: 86,268,801 D329E probably benign Het
Olfr43 A T 11: 74,206,640 I192N probably damaging Het
Olfr715b A T 7: 107,106,507 M118K probably damaging Het
Osbpl10 A G 9: 115,109,487 S211G probably benign Het
Pabpc6 G A 17: 9,668,155 A489V probably benign Het
Pcdhb13 A T 18: 37,443,421 D284V possibly damaging Het
Pde6c T C 19: 38,140,229 S214P possibly damaging Het
Pofut1 C T 2: 153,259,616 H192Y probably damaging Het
Pou3f2 T C 4: 22,486,960 D391G possibly damaging Het
Prc1 G A 7: 80,304,796 S165N probably benign Het
Prex1 A G 2: 166,572,963 V304A probably benign Het
Ptpru T C 4: 131,785,754 I881V probably benign Het
Radil A G 5: 142,487,115 S847P probably benign Het
Rimklb A G 6: 122,456,412 S317P probably damaging Het
Sdhc A T 1: 171,138,702 L78* probably null Het
Skint6 T A 4: 112,839,313 I1042F possibly damaging Het
Slc1a6 T A 10: 78,801,907 D422E probably damaging Het
Slc29a1 A T 17: 45,589,928 H71Q probably damaging Het
Slfn14 A T 11: 83,276,603 D695E probably damaging Het
Spg11 A T 2: 122,086,805 probably null Het
Srgap2 A G 1: 131,289,616 V986A probably benign Het
Stab1 A T 14: 31,162,519 C172* probably null Het
Tigd4 A G 3: 84,595,267 H497R probably benign Het
Ubn2 G A 6: 38,461,536 G60D probably damaging Het
Uckl1 C T 2: 181,573,073 probably null Het
Vmn2r24 A T 6: 123,816,277 K854N probably benign Het
Vps13d G A 4: 144,975,193 Q3193* probably null Het
Wdr26 G A 1: 181,191,868 L315F probably damaging Het
Zc3h8 C A 2: 128,943,855 E24* probably null Het
Zfp39 A G 11: 58,891,387 V183A probably benign Het
Zfp608 C A 18: 54,988,544 probably benign Het
Other mutations in Emc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Emc1 APN 4 139355082 splice site probably benign
IGL00898:Emc1 APN 4 139371630 missense probably damaging 1.00
IGL01481:Emc1 APN 4 139362099 missense probably benign 0.00
IGL02174:Emc1 APN 4 139371668 missense possibly damaging 0.95
IGL02264:Emc1 APN 4 139375464 missense probably damaging 1.00
IGL02501:Emc1 APN 4 139370984 missense probably benign 0.00
IGL02697:Emc1 APN 4 139352644 missense probably benign
IGL03355:Emc1 APN 4 139371593 splice site probably benign
IGL03386:Emc1 APN 4 139363781 critical splice donor site probably null
PIT4480001:Emc1 UTSW 4 139359277 missense possibly damaging 0.69
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0051:Emc1 UTSW 4 139375163 missense possibly damaging 0.81
R0094:Emc1 UTSW 4 139360485 missense probably damaging 0.99
R0613:Emc1 UTSW 4 139375072 splice site probably benign
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1512:Emc1 UTSW 4 139360184 splice site probably null
R1702:Emc1 UTSW 4 139375201 missense probably damaging 1.00
R1839:Emc1 UTSW 4 139360485 missense probably damaging 0.98
R1843:Emc1 UTSW 4 139375512 missense probably benign 0.02
R1850:Emc1 UTSW 4 139359373 splice site probably benign
R2024:Emc1 UTSW 4 139360946 missense possibly damaging 0.95
R2196:Emc1 UTSW 4 139366530 missense probably benign 0.08
R2912:Emc1 UTSW 4 139365260 missense possibly damaging 0.51
R3696:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3697:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3698:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3803:Emc1 UTSW 4 139367163 missense possibly damaging 0.91
R3923:Emc1 UTSW 4 139363185 nonsense probably null
R4738:Emc1 UTSW 4 139362202 missense possibly damaging 0.52
R4914:Emc1 UTSW 4 139375165 nonsense probably null
R5033:Emc1 UTSW 4 139371696 missense probably damaging 1.00
R5322:Emc1 UTSW 4 139354246 missense probably damaging 1.00
R5375:Emc1 UTSW 4 139366491 missense probably damaging 0.96
R5483:Emc1 UTSW 4 139375376 missense probably damaging 1.00
R5587:Emc1 UTSW 4 139362148 missense probably damaging 0.98
R5687:Emc1 UTSW 4 139375380 missense probably damaging 1.00
R5938:Emc1 UTSW 4 139357620 missense probably benign
R6056:Emc1 UTSW 4 139354222 missense possibly damaging 0.51
R6170:Emc1 UTSW 4 139366378 missense probably benign 0.01
R6208:Emc1 UTSW 4 139354271 missense probably damaging 0.99
R6340:Emc1 UTSW 4 139365563 missense probably damaging 1.00
R6371:Emc1 UTSW 4 139371665 nonsense probably null
R6889:Emc1 UTSW 4 139365350 missense probably damaging 0.97
R7592:Emc1 UTSW 4 139360566 missense probably benign 0.00
R7699:Emc1 UTSW 4 139354870 missense probably benign
R7715:Emc1 UTSW 4 139371623 missense probably damaging 1.00
R7984:Emc1 UTSW 4 139375449 missense probably damaging 1.00
R8112:Emc1 UTSW 4 139367187 missense probably benign 0.00
R8325:Emc1 UTSW 4 139365210 missense possibly damaging 0.94
R8387:Emc1 UTSW 4 139361289 missense probably benign
R8751:Emc1 UTSW 4 139369968 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- CAGGGATTCCTCATGGCTTC -3'
(R):5'- TGAGCACCTTATGAAGCCAG -3'

Sequencing Primer
(F):5'- TCACCTGGAGGACGTGC -3'
(R):5'- CCAGGCGCTCACAAGGG -3'
Posted On2017-10-10