Mutagenetix > Incidental Mutation

Incidental Mutation 'R0525:Atp1a4'

48819

Institutional Source

Beutler Lab

Gene Symbol

Atp1a4

Ensembl Gene

ENSMUSG00000007107

Gene Name

ATPase, Na+/K+ transporting, alpha 4 polypeptide

Synonyms

MMRRC Submission

038718-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0525 (G1)

Quality Score

147

Status

Validated

Chromosome

Chromosomal Location

172223513-172258414 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 172239688 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000106874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111243]

AlphaFold

Q9WV27

Predicted Effect

probably benign
Transcript: ENSMUST00000111243

SMART Domains

Protein: ENSMUSP00000106874
Gene: ENSMUSG00000007107

Domain	Start	End	E-Value	Type
low complexity region	33	50	N/A	INTRINSIC
Cation_ATPase_N	51	125	1.22e-14	SMART
Pfam:E1-E2_ATPase	144	375	2.6e-59	PFAM
Pfam:Hydrolase	380	738	8.1e-19	PFAM
Pfam:HAD	383	735	1.6e-17	PFAM
Pfam:Cation_ATPase	437	531	9.2e-25	PFAM
Pfam:Cation_ATPase_C	808	1017	1.2e-47	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191616

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.8%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 4 subunit. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit infertility associated with asthenozoospermia and teratozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933440M02Rik	T	A	7: 125,331,499		noncoding transcript	Het
A930002H24Rik	A	G	17: 63,863,647	W49R	unknown	Het
Abca13	G	A	11: 9,293,371	V1745M	probably damaging	Het
Abca16	T	G	7: 120,465,810	Y563*	probably null	Het
Acot12	C	T	13: 91,760,067		probably benign	Het
Alms1	G	A	6: 85,587,760	A39T	unknown	Het
Arid5b	T	C	10: 68,097,846	D742G	possibly damaging	Het
AU021092	T	A	16: 5,217,861	E145V	possibly damaging	Het
Calr4	A	T	4: 109,242,264		probably benign	Het
Clip4	T	A	17: 71,799,098		probably null	Het
Cnpy4	A	T	5: 138,192,616	H180L	probably benign	Het
Cyp2j9	T	C	4: 96,579,565		probably null	Het
Dgkq	A	G	5: 108,654,615	S406P	probably damaging	Het
Dhx8	G	A	11: 101,763,928	C1014Y	probably damaging	Het
Dnah3	T	C	7: 119,928,754	Y3824C	probably damaging	Het
Donson	A	T	16: 91,686,245	H69Q	probably damaging	Het
Dppa3	A	G	6: 122,629,980	E143G	probably damaging	Het
Drg1	A	G	11: 3,262,545	F96L	probably damaging	Het
Dvl1	A	C	4: 155,855,595	T395P	probably damaging	Het
Eftud2	A	T	11: 102,839,253	V897D	probably damaging	Het
Enpp6	A	G	8: 47,082,443	N341S	possibly damaging	Het
F11	A	G	8: 45,253,049	F100L	probably benign	Het
Fas	T	C	19: 34,319,327	Y189H	probably damaging	Het
Galnt14	G	T	17: 73,545,081	S114R	probably damaging	Het
Gfpt2	A	G	11: 49,829,775	I528V	probably benign	Het
Glt6d1	A	G	2: 25,794,268	V242A	possibly damaging	Het
Grm1	A	T	10: 10,719,209		probably benign	Het
Gskip	G	A	12: 105,698,965	A88T	probably damaging	Het
Gtpbp1	A	G	15: 79,713,447	I348V	probably benign	Het
Hnrnpul1	C	A	7: 25,740,883	R316L	possibly damaging	Het
Il34	T	C	8: 110,748,283	E121G	probably damaging	Het
Lrr1	T	C	12: 69,168,911	L19P	probably damaging	Het
Mat2b	A	G	11: 40,682,669		probably benign	Het
Mettl21e	T	C	1: 44,206,382	K235E	probably damaging	Het
Mir124-2hg	T	A	3: 17,785,529	E126V	possibly damaging	Het
Myh15	A	G	16: 49,132,051	K828R	probably benign	Het
Myom3	A	G	4: 135,764,926	D127G	possibly damaging	Het
Nek5	C	A	8: 22,079,077		probably benign	Het
Nudt7	A	T	8: 114,151,652		probably null	Het
Olfr1056	C	T	2: 86,356,275	V36I	probably benign	Het
Olfr1118	A	T	2: 87,309,349	T187S	probably benign	Het
Olfr1200	G	A	2: 88,767,314	Q334*	probably null	Het
Olfr350	T	C	2: 36,850,190	L48P	probably damaging	Het
Olfr961	T	G	9: 39,647,471	C248W	probably damaging	Het
Phyhd1	A	G	2: 30,281,028	H241R	probably damaging	Het
Pmch	T	C	10: 88,091,400		probably benign	Het
Ror1	A	G	4: 100,441,520	S697G	probably damaging	Het
Rslcan18	A	G	13: 67,112,258	V25A	probably benign	Het
Sema6b	T	C	17: 56,126,630	H426R	probably damaging	Het
Serpina3g	T	C	12: 104,238,339	F9S	probably damaging	Het
Serpinb12	T	A	1: 106,946,702	H52Q	probably benign	Het
Sh3gl1	T	C	17: 56,017,873	K294R	probably benign	Het
Sidt1	G	T	16: 44,259,446	T615K	possibly damaging	Het
Slc16a4	A	C	3: 107,297,939		probably benign	Het
Sned1	T	A	1: 93,271,974		probably null	Het
Sp2	A	T	11: 96,956,098		probably benign	Het
Steap1	T	A	5: 5,742,903	I3F	possibly damaging	Het
Stxbp5l	A	T	16: 37,129,797		probably null	Het
Tbc1d9	G	T	8: 83,268,985	V968F	probably benign	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Triobp	T	C	15: 78,973,898	L1233P	possibly damaging	Het
Trp53bp1	C	A	2: 121,251,868	A317S	probably null	Het
Trpc4ap	A	G	2: 155,640,478	F531L	possibly damaging	Het
Ugt1a10	C	T	1: 88,218,249	P473L	probably damaging	Het
Vmn1r86	T	C	7: 13,102,161	K213E	probably benign	Het
Vps8	G	A	16: 21,540,109		probably null	Het
Wnk1	A	T	6: 119,926,564	S2563T	probably damaging	Het
Yrdc	C	G	4: 124,851,766	R3G	probably damaging	Het
Zfp287	A	T	11: 62,715,244	V279E	probably benign	Het

Other mutations in Atp1a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Atp1a4	APN	1	172239806	missense	probably damaging	1.00
IGL00924:Atp1a4	APN	1	172246772	missense	probably damaging	1.00
IGL01288:Atp1a4	APN	1	172257907	missense	possibly damaging	0.77
IGL01665:Atp1a4	APN	1	172246724	missense	probably benign
IGL02156:Atp1a4	APN	1	172257962	missense	probably benign
IGL02170:Atp1a4	APN	1	172234536	missense	possibly damaging	0.94
IGL02228:Atp1a4	APN	1	172254885	missense	possibly damaging	0.69
IGL02505:Atp1a4	APN	1	172235075	missense	probably damaging	1.00
IGL02653:Atp1a4	APN	1	172251406	missense	possibly damaging	0.81
IGL02792:Atp1a4	APN	1	172227299	critical splice donor site	probably null
IGL02794:Atp1a4	APN	1	172244086	missense	probably benign	0.13
IGL03102:Atp1a4	APN	1	172231151	missense	probably damaging	1.00
R0046:Atp1a4	UTSW	1	172240097	missense	probably benign	0.09
R0046:Atp1a4	UTSW	1	172240097	missense	probably benign	0.09
R0276:Atp1a4	UTSW	1	172257901	missense	probably damaging	1.00
R0309:Atp1a4	UTSW	1	172234987	missense	probably damaging	1.00
R0615:Atp1a4	UTSW	1	172232060	splice site	probably benign
R0730:Atp1a4	UTSW	1	172240207	splice site	probably benign
R1412:Atp1a4	UTSW	1	172232009	missense	probably damaging	0.97
R1652:Atp1a4	UTSW	1	172254903	missense	probably damaging	1.00
R1898:Atp1a4	UTSW	1	172235048	missense	probably damaging	0.99
R1968:Atp1a4	UTSW	1	172240164	missense	probably benign
R2291:Atp1a4	UTSW	1	172244906	missense	probably damaging	1.00
R2897:Atp1a4	UTSW	1	172246690	missense	probably damaging	1.00
R2908:Atp1a4	UTSW	1	172234477	missense	probably benign
R3119:Atp1a4	UTSW	1	172239826	missense	probably damaging	0.99
R3731:Atp1a4	UTSW	1	172233961	missense	probably damaging	1.00
R4447:Atp1a4	UTSW	1	172234431	missense	probably damaging	0.99
R4602:Atp1a4	UTSW	1	172239765	missense	probably damaging	1.00
R4670:Atp1a4	UTSW	1	172235000	missense	probably benign	0.07
R4674:Atp1a4	UTSW	1	172257656	missense	possibly damaging	0.81
R4675:Atp1a4	UTSW	1	172257656	missense	possibly damaging	0.81
R4785:Atp1a4	UTSW	1	172254110	nonsense	probably null
R4958:Atp1a4	UTSW	1	172231151	missense	probably damaging	1.00
R5015:Atp1a4	UTSW	1	172254082	missense	probably damaging	1.00
R5149:Atp1a4	UTSW	1	172232005	missense	probably damaging	1.00
R5234:Atp1a4	UTSW	1	172227170	missense	possibly damaging	0.73
R5501:Atp1a4	UTSW	1	172246832	missense	probably damaging	1.00
R5682:Atp1a4	UTSW	1	172254163	missense	probably damaging	0.99
R5872:Atp1a4	UTSW	1	172244408	missense	probably damaging	1.00
R5933:Atp1a4	UTSW	1	172232274	missense	possibly damaging	0.91
R6722:Atp1a4	UTSW	1	172258050	unclassified	probably benign
R7087:Atp1a4	UTSW	1	172246702	missense	probably damaging	1.00
R7122:Atp1a4	UTSW	1	172231936	missense	possibly damaging	0.47
R7381:Atp1a4	UTSW	1	172240115	missense	possibly damaging	0.70
R7431:Atp1a4	UTSW	1	172250907	missense	probably benign	0.31
R8269:Atp1a4	UTSW	1	172232325	missense	probably damaging	1.00
R8400:Atp1a4	UTSW	1	172234494	missense	probably damaging	1.00
R8559:Atp1a4	UTSW	1	172251330	missense	probably damaging	1.00
R8680:Atp1a4	UTSW	1	172250999	missense	probably damaging	1.00
R8777:Atp1a4	UTSW	1	172232302	missense	probably damaging	1.00
R8777-TAIL:Atp1a4	UTSW	1	172232302	missense	probably damaging	1.00
R8867:Atp1a4	UTSW	1	172244924	missense	probably damaging	0.99
R8869:Atp1a4	UTSW	1	172227123	missense	probably benign
R9260:Atp1a4	UTSW	1	172246792	missense	probably damaging	1.00
R9300:Atp1a4	UTSW	1	172239831	missense	probably damaging	1.00
R9545:Atp1a4	UTSW	1	172250897	missense	probably benign	0.35
Z1176:Atp1a4	UTSW	1	172231954	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- CACATTGGTCGAAGCACTGTGTTTG -3'
(R):5'- TCCAGTTTCCTGCTGAATGGGC -3'

Sequencing Primer
(F):5'- actgatgcctaagagtcatcc -3'
(R):5'- TGGACTTCCAGAATGCCTACATAG -3'

Posted On

2013-06-12