Incidental Mutation 'R6174:Slfn14'
ID488210
Institutional Source Beutler Lab
Gene Symbol Slfn14
Ensembl Gene ENSMUSG00000082101
Gene Nameschlafen 14
SynonymsSlfn14-ps, LOC237890
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R6174 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location83275110-83286726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83276603 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 695 (D695E)
Ref Sequence ENSEMBL: ENSMUSP00000139132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163961]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082922
Predicted Effect probably damaging
Transcript: ENSMUST00000163961
AA Change: D695E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139132
Gene: ENSMUSG00000082101
AA Change: D695E

DomainStartEndE-ValueType
Pfam:AAA_4 195 329 1e-20 PFAM
low complexity region 539 551 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays an important role in platelet formation and function. Defects in this gene are a cause of thrombocytopenia with excessive bleeding. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T A 6: 91,942,536 D725E probably damaging Het
9530053A07Rik A G 7: 28,139,959 Y399C probably damaging Het
Bco1 T A 8: 117,113,534 Y264N probably damaging Het
Cd109 G A 9: 78,665,546 probably null Het
Cdc45 T C 16: 18,794,704 probably null Het
Ckap5 A G 2: 91,568,219 E578G probably benign Het
Cracr2b T A 7: 141,464,836 L193Q probably damaging Het
D11Wsu47e C A 11: 113,688,975 H399N possibly damaging Het
Dmxl2 G A 9: 54,393,727 L2367F probably damaging Het
Dopey2 T G 16: 93,766,222 D871E probably damaging Het
Emc1 T C 4: 139,366,531 Y651H probably benign Het
Enox1 T C 14: 77,508,187 S41P possibly damaging Het
Foxa1 A G 12: 57,542,900 L178P probably damaging Het
Gm10639 T A 9: 78,304,455 Y166* probably null Het
Grm7 T A 6: 111,246,297 Y433N probably benign Het
Gtf3c2 G A 5: 31,158,211 R813C probably damaging Het
Hacd3 T C 9: 65,005,627 E117G probably damaging Het
Hist1h4i T A 13: 22,041,077 T83S probably benign Het
Hmcn1 G A 1: 150,646,784 T3455M probably benign Het
Itga6 A G 2: 71,833,709 I61V possibly damaging Het
Jaml T C 9: 45,088,773 L81P probably damaging Het
Loxhd1 T C 18: 77,412,178 F782S probably damaging Het
Lrp1b T C 2: 41,449,263 H742R probably benign Het
Macrod2 G T 2: 140,400,975 M1I probably null Het
Mcf2l G A 8: 13,013,849 W1020* probably null Het
Msgn1 A G 12: 11,208,923 L9P probably damaging Het
Ngdn C A 14: 55,022,099 S202R probably benign Het
Notch1 C T 2: 26,485,442 G50R possibly damaging Het
Olfr1162 A T 2: 88,050,302 C107* probably null Het
Olfr310 A T 7: 86,268,801 D329E probably benign Het
Olfr43 A T 11: 74,206,640 I192N probably damaging Het
Olfr715b A T 7: 107,106,507 M118K probably damaging Het
Osbpl10 A G 9: 115,109,487 S211G probably benign Het
Pabpc6 G A 17: 9,668,155 A489V probably benign Het
Pcdhb13 A T 18: 37,443,421 D284V possibly damaging Het
Pde6c T C 19: 38,140,229 S214P possibly damaging Het
Pofut1 C T 2: 153,259,616 H192Y probably damaging Het
Pou3f2 T C 4: 22,486,960 D391G possibly damaging Het
Prc1 G A 7: 80,304,796 S165N probably benign Het
Prex1 A G 2: 166,572,963 V304A probably benign Het
Ptpru T C 4: 131,785,754 I881V probably benign Het
Radil A G 5: 142,487,115 S847P probably benign Het
Rimklb A G 6: 122,456,412 S317P probably damaging Het
Sdhc A T 1: 171,138,702 L78* probably null Het
Skint6 T A 4: 112,839,313 I1042F possibly damaging Het
Slc1a6 T A 10: 78,801,907 D422E probably damaging Het
Slc29a1 A T 17: 45,589,928 H71Q probably damaging Het
Spg11 A T 2: 122,086,805 probably null Het
Srgap2 A G 1: 131,289,616 V986A probably benign Het
Stab1 A T 14: 31,162,519 C172* probably null Het
Tigd4 A G 3: 84,595,267 H497R probably benign Het
Ubn2 G A 6: 38,461,536 G60D probably damaging Het
Uckl1 C T 2: 181,573,073 probably null Het
Vmn2r24 A T 6: 123,816,277 K854N probably benign Het
Vps13d G A 4: 144,975,193 Q3193* probably null Het
Wdr26 G A 1: 181,191,868 L315F probably damaging Het
Zc3h8 C A 2: 128,943,855 E24* probably null Het
Zfp39 A G 11: 58,891,387 V183A probably benign Het
Zfp608 C A 18: 54,988,544 probably benign Het
Other mutations in Slfn14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03214:Slfn14 APN 11 83279000 missense probably benign 0.01
IGL03402:Slfn14 APN 11 83276313 missense probably benign 0.00
R2520:Slfn14 UTSW 11 83276187 missense probably damaging 0.99
R2570:Slfn14 UTSW 11 83283607 missense probably benign 0.02
R3082:Slfn14 UTSW 11 83276693 nonsense probably null
R4611:Slfn14 UTSW 11 83283314 nonsense probably null
R4647:Slfn14 UTSW 11 83276658 missense probably benign 0.01
R4722:Slfn14 UTSW 11 83283418 missense probably benign 0.27
R4833:Slfn14 UTSW 11 83279156 missense probably damaging 1.00
R4876:Slfn14 UTSW 11 83276272 missense possibly damaging 0.87
R5209:Slfn14 UTSW 11 83279633 missense possibly damaging 0.95
R5776:Slfn14 UTSW 11 83283599 missense probably damaging 1.00
R5933:Slfn14 UTSW 11 83279462 missense probably damaging 0.97
R6826:Slfn14 UTSW 11 83281818 critical splice donor site probably null
R7042:Slfn14 UTSW 11 83276604 missense probably damaging 1.00
R7070:Slfn14 UTSW 11 83276705 missense probably benign 0.27
R7191:Slfn14 UTSW 11 83276749 missense probably benign
R7207:Slfn14 UTSW 11 83279388 nonsense probably null
R7297:Slfn14 UTSW 11 83278995 nonsense probably null
R7829:Slfn14 UTSW 11 83281817 critical splice donor site probably null
R8094:Slfn14 UTSW 11 83283293 nonsense probably null
R8263:Slfn14 UTSW 11 83283473 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CGCATTGCTTCCTCATAGGG -3'
(R):5'- TACAGGCAGCAAGTCACCTG -3'

Sequencing Primer
(F):5'- TCATAGGGAGCCTCCTGGAAC -3'
(R):5'- AAGTCACCTGCCGAGCTGTG -3'
Posted On2017-10-10