Incidental Mutation 'R6174:Ngdn'
ID488216
Institutional Source Beutler Lab
Gene Symbol Ngdn
Ensembl Gene ENSMUSG00000022204
Gene Nameneuroguidin, EIF4E binding protein
Synonyms1500001L15Rik, Ngd, neuroguidin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6174 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location55015454-55024137 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 55022099 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 202 (S202R)
Ref Sequence ENSEMBL: ENSMUSP00000022815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022815]
Predicted Effect probably benign
Transcript: ENSMUST00000022815
AA Change: S202R

PolyPhen 2 Score 0.384 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022815
Gene: ENSMUSG00000022204
AA Change: S202R

DomainStartEndE-ValueType
Pfam:Sas10_Utp3 18 98 1.3e-18 PFAM
low complexity region 142 170 N/A INTRINSIC
low complexity region 296 314 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227833
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neuroguidin is an EIF4E (MIM 133440)-binding protein that interacts with CPEB (MIM 607342) and functions as a translational regulatory protein during development of the vertebrate nervous system (Jung et al., 2006 [PubMed 16705177]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T A 6: 91,942,536 D725E probably damaging Het
9530053A07Rik A G 7: 28,139,959 Y399C probably damaging Het
Bco1 T A 8: 117,113,534 Y264N probably damaging Het
Cd109 G A 9: 78,665,546 probably null Het
Cdc45 T C 16: 18,794,704 probably null Het
Ckap5 A G 2: 91,568,219 E578G probably benign Het
Cracr2b T A 7: 141,464,836 L193Q probably damaging Het
D11Wsu47e C A 11: 113,688,975 H399N possibly damaging Het
Dmxl2 G A 9: 54,393,727 L2367F probably damaging Het
Dopey2 T G 16: 93,766,222 D871E probably damaging Het
Emc1 T C 4: 139,366,531 Y651H probably benign Het
Enox1 T C 14: 77,508,187 S41P possibly damaging Het
Foxa1 A G 12: 57,542,900 L178P probably damaging Het
Gm10639 T A 9: 78,304,455 Y166* probably null Het
Grm7 T A 6: 111,246,297 Y433N probably benign Het
Gtf3c2 G A 5: 31,158,211 R813C probably damaging Het
Hacd3 T C 9: 65,005,627 E117G probably damaging Het
Hist1h4i T A 13: 22,041,077 T83S probably benign Het
Hmcn1 G A 1: 150,646,784 T3455M probably benign Het
Itga6 A G 2: 71,833,709 I61V possibly damaging Het
Jaml T C 9: 45,088,773 L81P probably damaging Het
Loxhd1 T C 18: 77,412,178 F782S probably damaging Het
Lrp1b T C 2: 41,449,263 H742R probably benign Het
Macrod2 G T 2: 140,400,975 M1I probably null Het
Mcf2l G A 8: 13,013,849 W1020* probably null Het
Msgn1 A G 12: 11,208,923 L9P probably damaging Het
Notch1 C T 2: 26,485,442 G50R possibly damaging Het
Olfr1162 A T 2: 88,050,302 C107* probably null Het
Olfr310 A T 7: 86,268,801 D329E probably benign Het
Olfr43 A T 11: 74,206,640 I192N probably damaging Het
Olfr715b A T 7: 107,106,507 M118K probably damaging Het
Osbpl10 A G 9: 115,109,487 S211G probably benign Het
Pabpc6 G A 17: 9,668,155 A489V probably benign Het
Pcdhb13 A T 18: 37,443,421 D284V possibly damaging Het
Pde6c T C 19: 38,140,229 S214P possibly damaging Het
Pofut1 C T 2: 153,259,616 H192Y probably damaging Het
Pou3f2 T C 4: 22,486,960 D391G possibly damaging Het
Prc1 G A 7: 80,304,796 S165N probably benign Het
Prex1 A G 2: 166,572,963 V304A probably benign Het
Ptpru T C 4: 131,785,754 I881V probably benign Het
Radil A G 5: 142,487,115 S847P probably benign Het
Rimklb A G 6: 122,456,412 S317P probably damaging Het
Sdhc A T 1: 171,138,702 L78* probably null Het
Skint6 T A 4: 112,839,313 I1042F possibly damaging Het
Slc1a6 T A 10: 78,801,907 D422E probably damaging Het
Slc29a1 A T 17: 45,589,928 H71Q probably damaging Het
Slfn14 A T 11: 83,276,603 D695E probably damaging Het
Spg11 A T 2: 122,086,805 probably null Het
Srgap2 A G 1: 131,289,616 V986A probably benign Het
Stab1 A T 14: 31,162,519 C172* probably null Het
Tigd4 A G 3: 84,595,267 H497R probably benign Het
Ubn2 G A 6: 38,461,536 G60D probably damaging Het
Uckl1 C T 2: 181,573,073 probably null Het
Vmn2r24 A T 6: 123,816,277 K854N probably benign Het
Vps13d G A 4: 144,975,193 Q3193* probably null Het
Wdr26 G A 1: 181,191,868 L315F probably damaging Het
Zc3h8 C A 2: 128,943,855 E24* probably null Het
Zfp39 A G 11: 58,891,387 V183A probably benign Het
Zfp608 C A 18: 54,988,544 probably benign Het
Other mutations in Ngdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Ngdn APN 14 55023169 missense probably damaging 0.99
IGL01301:Ngdn APN 14 55017114 missense probably benign 0.15
IGL02350:Ngdn APN 14 55021936 missense probably damaging 1.00
IGL02357:Ngdn APN 14 55021936 missense probably damaging 1.00
ANU18:Ngdn UTSW 14 55017114 missense probably benign 0.15
PIT4651001:Ngdn UTSW 14 55016200 missense probably benign 0.05
R2062:Ngdn UTSW 14 55022107 missense possibly damaging 0.93
R2251:Ngdn UTSW 14 55023395 critical splice donor site probably null
R5167:Ngdn UTSW 14 55022199 nonsense probably null
R5492:Ngdn UTSW 14 55023052 missense probably benign 0.00
R6712:Ngdn UTSW 14 55016188 missense probably benign 0.18
R7866:Ngdn UTSW 14 55021097 missense probably damaging 1.00
R8303:Ngdn UTSW 14 55023145 missense probably benign 0.01
X0025:Ngdn UTSW 14 55021915 missense possibly damaging 0.71
Z1177:Ngdn UTSW 14 55021944 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GGCTCAGCTAAGAAATACGTCC -3'
(R):5'- TTCCTGGGCCACACGTAATC -3'

Sequencing Primer
(F):5'- TAAGAAATACGTCCCGCCACG -3'
(R):5'- AATCGTGCTCACACACAG -3'
Posted On2017-10-10