Incidental Mutation 'R6174:Slc29a1'
ID488220
Institutional Source Beutler Lab
Gene Symbol Slc29a1
Ensembl Gene ENSMUSG00000023942
Gene Namesolute carrier family 29 (nucleoside transporters), member 1
SynonymsENT1, 1200014D21Rik, NBMPR-sensitive equilibrative nucleoside transporter
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6174 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location45585200-45599606 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45589928 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 71 (H71Q)
Ref Sequence ENSEMBL: ENSMUSP00000133162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051574] [ENSMUST00000064889] [ENSMUST00000097317] [ENSMUST00000163492] [ENSMUST00000163905] [ENSMUST00000164217] [ENSMUST00000164618] [ENSMUST00000164769] [ENSMUST00000166119] [ENSMUST00000166633] [ENSMUST00000167195] [ENSMUST00000167332] [ENSMUST00000167692] [ENSMUST00000172301] [ENSMUST00000169729] [ENSMUST00000171081] [ENSMUST00000171847] [ENSMUST00000168274] [ENSMUST00000170488] [ENSMUST00000170113]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051574
AA Change: H103Q

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000063096
Gene: ENSMUSG00000023942
AA Change: H103Q

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 458 4.5e-131 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000064889
AA Change: H103Q

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000063757
Gene: ENSMUSG00000023942
AA Change: H103Q

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 456 2.1e-130 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000087588
Predicted Effect possibly damaging
Transcript: ENSMUST00000097317
AA Change: H103Q

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000094923
Gene: ENSMUSG00000023942
AA Change: H103Q

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 458 4.5e-131 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163492
AA Change: H103Q

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129242
Gene: ENSMUSG00000023942
AA Change: H103Q

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 456 2.1e-130 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163905
AA Change: H103Q

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000129240
Gene: ENSMUSG00000023942
AA Change: H103Q

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
transmembrane domain 109 130 N/A INTRINSIC
transmembrane domain 135 157 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164217
AA Change: H103Q

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000131646
Gene: ENSMUSG00000023942
AA Change: H103Q

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 262 8.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164618
AA Change: H103Q

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000126934
Gene: ENSMUSG00000023942
AA Change: H103Q

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
transmembrane domain 109 130 N/A INTRINSIC
transmembrane domain 135 157 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164769
AA Change: H103Q

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131116
Gene: ENSMUSG00000023942
AA Change: H103Q

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 358 2.7e-81 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166119
AA Change: H103Q

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128763
Gene: ENSMUSG00000023942
AA Change: H103Q

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 458 4.5e-131 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166633
AA Change: H103Q

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131075
Gene: ENSMUSG00000023942
AA Change: H103Q

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 195 1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167195
AA Change: H71Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133162
Gene: ENSMUSG00000023942
AA Change: H71Q

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 77 98 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167332
SMART Domains Protein: ENSMUSP00000131483
Gene: ENSMUSG00000023942

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167692
AA Change: H103Q

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131976
Gene: ENSMUSG00000023942
AA Change: H103Q

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 458 4.5e-131 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167748
Predicted Effect probably benign
Transcript: ENSMUST00000172301
AA Change: H103Q

PolyPhen 2 Score 0.215 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129345
Gene: ENSMUSG00000023942
AA Change: H103Q

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169729
AA Change: H71Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127343
Gene: ENSMUSG00000023942
AA Change: H71Q

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171081
AA Change: H103Q

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000131217
Gene: ENSMUSG00000023942
AA Change: H103Q

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 262 8.4e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171847
AA Change: H103Q

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126703
Gene: ENSMUSG00000023942
AA Change: H103Q

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 456 2.1e-130 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171978
Predicted Effect probably benign
Transcript: ENSMUST00000168274
Predicted Effect probably benign
Transcript: ENSMUST00000170488
Predicted Effect probably benign
Transcript: ENSMUST00000170113
SMART Domains Protein: ENSMUSP00000128304
Gene: ENSMUSG00000023942

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the equilibrative nucleoside transporter family. The gene encodes a transmembrane glycoprotein that localizes to the plasma and mitochondrial membranes and mediates the cellular uptake of nucleosides from the surrounding medium. The protein is categorized as an equilibrative (as opposed to concentrative) transporter that is sensitive to inhibition by nitrobenzylthioinosine (NBMPR). Nucleoside transporters are required for nucleotide synthesis in cells that lack de novo nucleoside synthesis pathways, and are also necessary for the uptake of cytotoxic nucleosides used for cancer and viral chemotherapies. Multiple alternatively spliced variants, encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null allele exhibit a slightly decreased body weight, increased alcohol preference and alcohol consumption, and reduced hypnotic and ataxic responses to ethanol associated with a reduction in adenosine tone. Adenosine uptake is almost completely abolished in mice homozygous for a knock-out allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T A 6: 91,942,536 D725E probably damaging Het
9530053A07Rik A G 7: 28,139,959 Y399C probably damaging Het
Bco1 T A 8: 117,113,534 Y264N probably damaging Het
Cd109 G A 9: 78,665,546 probably null Het
Cdc45 T C 16: 18,794,704 probably null Het
Ckap5 A G 2: 91,568,219 E578G probably benign Het
Cracr2b T A 7: 141,464,836 L193Q probably damaging Het
D11Wsu47e C A 11: 113,688,975 H399N possibly damaging Het
Dmxl2 G A 9: 54,393,727 L2367F probably damaging Het
Dopey2 T G 16: 93,766,222 D871E probably damaging Het
Emc1 T C 4: 139,366,531 Y651H probably benign Het
Enox1 T C 14: 77,508,187 S41P possibly damaging Het
Foxa1 A G 12: 57,542,900 L178P probably damaging Het
Gm10639 T A 9: 78,304,455 Y166* probably null Het
Grm7 T A 6: 111,246,297 Y433N probably benign Het
Gtf3c2 G A 5: 31,158,211 R813C probably damaging Het
Hacd3 T C 9: 65,005,627 E117G probably damaging Het
Hist1h4i T A 13: 22,041,077 T83S probably benign Het
Hmcn1 G A 1: 150,646,784 T3455M probably benign Het
Itga6 A G 2: 71,833,709 I61V possibly damaging Het
Jaml T C 9: 45,088,773 L81P probably damaging Het
Loxhd1 T C 18: 77,412,178 F782S probably damaging Het
Lrp1b T C 2: 41,449,263 H742R probably benign Het
Macrod2 G T 2: 140,400,975 M1I probably null Het
Mcf2l G A 8: 13,013,849 W1020* probably null Het
Msgn1 A G 12: 11,208,923 L9P probably damaging Het
Ngdn C A 14: 55,022,099 S202R probably benign Het
Notch1 C T 2: 26,485,442 G50R possibly damaging Het
Olfr1162 A T 2: 88,050,302 C107* probably null Het
Olfr310 A T 7: 86,268,801 D329E probably benign Het
Olfr43 A T 11: 74,206,640 I192N probably damaging Het
Olfr715b A T 7: 107,106,507 M118K probably damaging Het
Osbpl10 A G 9: 115,109,487 S211G probably benign Het
Pabpc6 G A 17: 9,668,155 A489V probably benign Het
Pcdhb13 A T 18: 37,443,421 D284V possibly damaging Het
Pde6c T C 19: 38,140,229 S214P possibly damaging Het
Pofut1 C T 2: 153,259,616 H192Y probably damaging Het
Pou3f2 T C 4: 22,486,960 D391G possibly damaging Het
Prc1 G A 7: 80,304,796 S165N probably benign Het
Prex1 A G 2: 166,572,963 V304A probably benign Het
Ptpru T C 4: 131,785,754 I881V probably benign Het
Radil A G 5: 142,487,115 S847P probably benign Het
Rimklb A G 6: 122,456,412 S317P probably damaging Het
Sdhc A T 1: 171,138,702 L78* probably null Het
Skint6 T A 4: 112,839,313 I1042F possibly damaging Het
Slc1a6 T A 10: 78,801,907 D422E probably damaging Het
Slfn14 A T 11: 83,276,603 D695E probably damaging Het
Spg11 A T 2: 122,086,805 probably null Het
Srgap2 A G 1: 131,289,616 V986A probably benign Het
Stab1 A T 14: 31,162,519 C172* probably null Het
Tigd4 A G 3: 84,595,267 H497R probably benign Het
Ubn2 G A 6: 38,461,536 G60D probably damaging Het
Uckl1 C T 2: 181,573,073 probably null Het
Vmn2r24 A T 6: 123,816,277 K854N probably benign Het
Vps13d G A 4: 144,975,193 Q3193* probably null Het
Wdr26 G A 1: 181,191,868 L315F probably damaging Het
Zc3h8 C A 2: 128,943,855 E24* probably null Het
Zfp39 A G 11: 58,891,387 V183A probably benign Het
Zfp608 C A 18: 54,988,544 probably benign Het
Other mutations in Slc29a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Slc29a1 APN 17 45589992 missense probably damaging 1.00
IGL01617:Slc29a1 APN 17 45589449 missense probably benign 0.02
IGL02154:Slc29a1 APN 17 45586163 missense probably damaging 1.00
soldate UTSW 17 45586263 missense probably damaging 1.00
veteran UTSW 17 45589921 critical splice donor site probably null
veterinarian UTSW 17 45586109 missense probably damaging 1.00
workhorse UTSW 17 45589066 nonsense probably null
R0288:Slc29a1 UTSW 17 45589804 missense probably damaging 1.00
R1168:Slc29a1 UTSW 17 45590278 missense probably damaging 1.00
R1676:Slc29a1 UTSW 17 45589010 missense probably damaging 0.98
R1777:Slc29a1 UTSW 17 45587308 missense probably damaging 1.00
R2032:Slc29a1 UTSW 17 45586109 missense probably damaging 1.00
R2413:Slc29a1 UTSW 17 45585717 missense probably damaging 1.00
R3917:Slc29a1 UTSW 17 45588973 splice site probably null
R4513:Slc29a1 UTSW 17 45589066 nonsense probably null
R4583:Slc29a1 UTSW 17 45589956 missense possibly damaging 0.67
R5244:Slc29a1 UTSW 17 45588413 unclassified probably benign
R6284:Slc29a1 UTSW 17 45589921 critical splice donor site probably null
R6446:Slc29a1 UTSW 17 45589245 missense possibly damaging 0.88
R6607:Slc29a1 UTSW 17 45588927 splice site probably null
R7133:Slc29a1 UTSW 17 45589971 missense possibly damaging 0.50
R7153:Slc29a1 UTSW 17 45585762 missense probably damaging 1.00
R7248:Slc29a1 UTSW 17 45592182 missense probably damaging 1.00
R7271:Slc29a1 UTSW 17 45588362 missense probably benign 0.01
R7604:Slc29a1 UTSW 17 45592324 splice site probably null
R7811:Slc29a1 UTSW 17 45586263 missense probably damaging 1.00
R8406:Slc29a1 UTSW 17 45589780 missense probably damaging 1.00
X0067:Slc29a1 UTSW 17 45590325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAATCTTGATCATGGTGATG -3'
(R):5'- ACGTGTCCCAGAATGTGTCC -3'

Sequencing Primer
(F):5'- TCTTGATCATGGTGATGACAAAGAAG -3'
(R):5'- GTCCTCGGACACTGATCAATCATG -3'
Posted On2017-10-10