Mutagenetix > Incidental Mutations

Incidental Mutation 'R6172:Itga10'

488231

Institutional Source

Beutler Lab

Gene Symbol

Itga10

Ensembl Gene

ENSMUSG00000090210

Gene Name

integrin, alpha 10

Synonyms

MMRRC Submission

044315-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.104) question?

Stock #

R6172 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

96645584-96664519 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 96647437 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 78 (I78T)

Ref Sequence

ENSEMBL: ENSMUSP00000112393 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000048766] [ENSMUST00000118557] [ENSMUST00000119365] [ENSMUST00000137564] [ENSMUST00000156015] [ENSMUST00000165842]

Predicted Effect

probably benign
Transcript: ENSMUST00000029744
AA Change: I78T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210
AA Change: I78T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1123	1145	N/A	INTRINSIC
low complexity region	1153	1166	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000048766

SMART Domains

Protein: ENSMUSP00000037962
Gene: ENSMUSG00000028102

Domain	Start	End	E-Value	Type
Pfam:PEX11	1	251	1.9e-76	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000118557

SMART Domains

Protein: ENSMUSP00000113365
Gene: ENSMUSG00000028102

Domain	Start	End	E-Value	Type
Pfam:PEX11	1	251	8.3e-77	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000119365
AA Change: I78T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210
AA Change: I78T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1122	1144	N/A	INTRINSIC
low complexity region	1152	1165	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000137564
AA Change: I263T

SMART Domains

Protein: ENSMUSP00000121011
Gene: ENSMUSG00000106447
AA Change: I263T

Domain	Start	End	E-Value	Type
Pfam:PEX11	1	172	4.5e-57	PFAM
low complexity region	186	204	N/A	INTRINSIC
Int_alpha	222	278	9.03e-3	SMART
Blast:VWA	292	345	3e-7	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144962

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147821

Predicted Effect

probably benign
Transcript: ENSMUST00000156015

Predicted Effect

probably benign
Transcript: ENSMUST00000165842

SMART Domains

Protein: ENSMUSP00000126631
Gene: ENSMUSG00000028102

Domain	Start	End	E-Value	Type
Pfam:PEX11	3	237	8.9e-69	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.5%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap42	A	T	9: 9,148,245	C108S	possibly damaging	Het
Bbs2	T	C	8: 94,087,411	E193G	probably benign	Het
Bpifb2	C	A	2: 153,890,412	H310Q	probably benign	Het
Cand2	A	G	6: 115,791,310	E472G	probably benign	Het
Cd81	A	G	7: 143,052,954		probably benign	Het
Chd5	A	T	4: 152,379,391	H1476L	probably damaging	Het
Clpx	C	A	9: 65,301,879	S92*	probably null	Het
Cstf3	T	C	2: 104,651,642	V276A	probably damaging	Het
Ehd4	G	A	2: 120,102,256	Q230*	probably null	Het
Erich3	A	G	3: 154,764,341	T4A	possibly damaging	Het
Erlin2	T	G	8: 27,036,095		probably null	Het
Exosc1	C	A	19: 41,924,003	Q148H	probably damaging	Het
Fbxw27	A	T	9: 109,772,269	V261E	probably damaging	Het
Flrt2	T	A	12: 95,779,531	N214K	probably damaging	Het
Foxp1	G	A	6: 99,015,510	Q41*	probably null	Het
Foxp1	C	A	6: 99,015,514		probably null	Het
Frk	T	C	10: 34,591,965	L325P	probably damaging	Het
Gm21698	T	C	5: 25,987,373	I72V	probably benign	Het
Gm39115	A	T	7: 142,135,914	C41S	unknown	Het
Hectd1	G	A	12: 51,769,282	P1336S	probably damaging	Het
Ighv7-1	T	C	12: 113,896,563	S70G	probably damaging	Het
Itgb4	A	G	11: 116,000,411	H1218R	probably benign	Het
March6	A	T	15: 31,482,867	N463K	possibly damaging	Het
Muc5b	A	C	7: 141,858,776	T1820P	unknown	Het
Nfatc4	A	G	14: 55,829,533	T510A	possibly damaging	Het
Nwd2	G	T	5: 63,806,906	V1278F	probably damaging	Het
Olfr668	A	C	7: 104,925,296	M156R	probably benign	Het
Olfr832	A	G	9: 18,944,746	T33A	probably benign	Het
P2rx1	G	A	11: 73,010,030	V209M	probably damaging	Het
Pkn1	T	C	8: 83,670,755	K874R	possibly damaging	Het
Plec	C	T	15: 76,172,376	V4444I	probably damaging	Het
Ppp1r37	A	T	7: 19,532,404	M479K	possibly damaging	Het
Prr11	A	C	11: 87,103,623	F66V	probably benign	Het
Rbbp5	A	G	1: 132,496,816	D268G	possibly damaging	Het
Rbbp6	T	A	7: 122,998,555	Y734*	probably null	Het
Rc3h2	GCC	GCCC	2: 37,414,733		probably null	Het
Rhou	A	G	8: 123,661,164	K212E	probably benign	Het
Rsph1	G	A	17: 31,273,418	T58I	probably benign	Het
Serpina3m	A	G	12: 104,389,227	N51S	probably damaging	Het
Shisa6	A	T	11: 66,218,006	D348E	probably benign	Het
Slc6a5	T	A	7: 49,948,333	Y648*	probably null	Het
Stag3	A	G	5: 138,299,843	D699G	probably benign	Het
Terf2ip	A	T	8: 112,018,017	D322V	probably damaging	Het
Vmn1r125	A	T	7: 21,272,350	M58L	probably benign	Het
Wdr49	T	A	3: 75,298,180	D643V	probably damaging	Het

Other mutations in Itga10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01473:Itga10	APN	3	96647641	missense	probably damaging	0.96
IGL01694:Itga10	APN	3	96652517	missense	probably damaging	0.99
IGL01754:Itga10	APN	3	96656775	unclassified	probably benign
IGL02527:Itga10	APN	3	96655624	unclassified	probably benign
IGL02956:Itga10	APN	3	96655113	missense	possibly damaging	0.46
IGL03371:Itga10	APN	3	96654788	missense	possibly damaging	0.84
IGL03055:Itga10	UTSW	3	96650520	missense	probably damaging	0.99
PIT4515001:Itga10	UTSW	3	96662632	missense	probably damaging	0.99
R0153:Itga10	UTSW	3	96653700	missense	probably benign	0.00
R0308:Itga10	UTSW	3	96651464	missense	probably damaging	1.00
R0331:Itga10	UTSW	3	96652483	missense	probably damaging	1.00
R0413:Itga10	UTSW	3	96649059	missense	probably damaging	1.00
R0437:Itga10	UTSW	3	96649137	missense	probably damaging	1.00
R0511:Itga10	UTSW	3	96658174	missense	probably damaging	1.00
R0630:Itga10	UTSW	3	96656299	unclassified	probably benign
R0844:Itga10	UTSW	3	96651738	splice site	probably benign
R0849:Itga10	UTSW	3	96652530	missense	possibly damaging	0.67
R0894:Itga10	UTSW	3	96653660	missense	possibly damaging	0.69
R0919:Itga10	UTSW	3	96651738	splice site	probably benign
R1027:Itga10	UTSW	3	96651738	splice site	probably benign
R1341:Itga10	UTSW	3	96652495	missense	probably damaging	1.00
R1350:Itga10	UTSW	3	96657477	missense	probably benign	0.01
R1370:Itga10	UTSW	3	96651738	splice site	probably benign
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1589:Itga10	UTSW	3	96651738	splice site	probably benign
R1590:Itga10	UTSW	3	96651738	splice site	probably benign
R1601:Itga10	UTSW	3	96653658	missense	possibly damaging	0.82
R1659:Itga10	UTSW	3	96662977	missense	probably damaging	0.96
R1665:Itga10	UTSW	3	96651738	splice site	probably benign
R1667:Itga10	UTSW	3	96651738	splice site	probably benign
R1686:Itga10	UTSW	3	96651825	missense	probably damaging	0.97
R1972:Itga10	UTSW	3	96651738	splice site	probably benign
R1976:Itga10	UTSW	3	96651738	splice site	probably benign
R2020:Itga10	UTSW	3	96652490	missense	probably damaging	1.00
R2040:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96657690	missense	probably benign
R2045:Itga10	UTSW	3	96651738	splice site	probably benign
R2060:Itga10	UTSW	3	96654998	nonsense	probably null
R2146:Itga10	UTSW	3	96651492	missense	possibly damaging	0.59
R2146:Itga10	UTSW	3	96653723	missense	probably damaging	1.00
R2170:Itga10	UTSW	3	96650457	missense	probably damaging	1.00
R2893:Itga10	UTSW	3	96655100	missense	probably benign	0.11
R2926:Itga10	UTSW	3	96652849	missense	probably damaging	1.00
R3622:Itga10	UTSW	3	96651738	splice site	probably benign
R3623:Itga10	UTSW	3	96651738	splice site	probably benign
R4416:Itga10	UTSW	3	96658246	missense	possibly damaging	0.58
R4633:Itga10	UTSW	3	96647704	missense	possibly damaging	0.92
R5074:Itga10	UTSW	3	96652211	nonsense	probably null
R5095:Itga10	UTSW	3	96648164	missense	probably benign	0.21
R5495:Itga10	UTSW	3	96647371	missense	possibly damaging	0.92
R5813:Itga10	UTSW	3	96652585	missense	probably benign	0.38
R6114:Itga10	UTSW	3	96649035	missense	probably damaging	1.00
R6275:Itga10	UTSW	3	96658185	missense	probably benign	0.36
R6298:Itga10	UTSW	3	96656762	missense	probably benign	0.00
R6433:Itga10	UTSW	3	96658041	critical splice donor site	probably null
R6841:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R6909:Itga10	UTSW	3	96662599	missense	probably benign	0.00
R6927:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R7124:Itga10	UTSW	3	96651765	missense	probably damaging	0.96
R7310:Itga10	UTSW	3	96648159	missense	probably damaging	1.00
R7387:Itga10	UTSW	3	96652778	missense	probably benign	0.11
R7464:Itga10	UTSW	3	96648155	missense	probably damaging	1.00
R7624:Itga10	UTSW	3	96652953	missense	probably benign
R7638:Itga10	UTSW	3	96657391	splice site	probably null
R7639:Itga10	UTSW	3	96649582	missense	probably benign	0.36
R7893:Itga10	UTSW	3	96649612	missense	probably damaging	1.00
R8297:Itga10	UTSW	3	96654800	missense	probably damaging	1.00
X0064:Itga10	UTSW	3	96652936	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CTGGCCTTTGAAAGTGCCTG -3'
(R):5'- CACAGCAGGCTGAGAGGAATTTC -3'

Sequencing Primer
(F):5'- TGGGGCTCCATGACGTCTC -3'
(R):5'- TCCAAGTTGATAGTCACCTGG -3'

Posted On

2017-10-10