Incidental Mutation 'R6172:Erlin2'
ID488248
Institutional Source Beutler Lab
Gene Symbol Erlin2
Ensembl Gene ENSMUSG00000031483
Gene NameER lipid raft associated 2
SynonymsSpfh2
MMRRC Submission 044315-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6172 (G1)
Quality Score188.009
Status Validated
Chromosome8
Chromosomal Location27023261-27040328 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 27036095 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000033873] [ENSMUST00000209520] [ENSMUST00000209563] [ENSMUST00000209795] [ENSMUST00000211043] [ENSMUST00000211233]
Predicted Effect probably null
Transcript: ENSMUST00000033873
SMART Domains Protein: ENSMUSP00000033873
Gene: ENSMUSG00000031483

DomainStartEndE-ValueType
PHB 21 187 1.62e-36 SMART
low complexity region 235 246 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000209504
Predicted Effect probably benign
Transcript: ENSMUST00000209520
Predicted Effect probably benign
Transcript: ENSMUST00000209563
Predicted Effect probably benign
Transcript: ENSMUST00000209795
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210445
Predicted Effect probably benign
Transcript: ENSMUST00000211043
Predicted Effect probably benign
Transcript: ENSMUST00000211233
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SPFH domain-containing family of lipid raft-associated proteins. The encoded protein is localized to lipid rafts of the endoplasmic reticulum and plays a critical role in inositol 1,4,5-trisphosphate (IP3) signaling by mediating ER-associated degradation of activated IP3 receptors. Mutations in this gene are a cause of spastic paraplegia-18 (SPG18). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap42 A T 9: 9,148,245 C108S possibly damaging Het
Bbs2 T C 8: 94,087,411 E193G probably benign Het
Bpifb2 C A 2: 153,890,412 H310Q probably benign Het
Cand2 A G 6: 115,791,310 E472G probably benign Het
Cd81 A G 7: 143,052,954 probably benign Het
Chd5 A T 4: 152,379,391 H1476L probably damaging Het
Clpx C A 9: 65,301,879 S92* probably null Het
Cstf3 T C 2: 104,651,642 V276A probably damaging Het
Ehd4 G A 2: 120,102,256 Q230* probably null Het
Erich3 A G 3: 154,764,341 T4A possibly damaging Het
Exosc1 C A 19: 41,924,003 Q148H probably damaging Het
Fbxw27 A T 9: 109,772,269 V261E probably damaging Het
Flrt2 T A 12: 95,779,531 N214K probably damaging Het
Foxp1 G A 6: 99,015,510 Q41* probably null Het
Foxp1 C A 6: 99,015,514 probably null Het
Frk T C 10: 34,591,965 L325P probably damaging Het
Gm21698 T C 5: 25,987,373 I72V probably benign Het
Gm39115 A T 7: 142,135,914 C41S unknown Het
Hectd1 G A 12: 51,769,282 P1336S probably damaging Het
Ighv7-1 T C 12: 113,896,563 S70G probably damaging Het
Itga10 T C 3: 96,647,437 I78T probably benign Het
Itgb4 A G 11: 116,000,411 H1218R probably benign Het
March6 A T 15: 31,482,867 N463K possibly damaging Het
Muc5b A C 7: 141,858,776 T1820P unknown Het
Nfatc4 A G 14: 55,829,533 T510A possibly damaging Het
Nwd2 G T 5: 63,806,906 V1278F probably damaging Het
Olfr668 A C 7: 104,925,296 M156R probably benign Het
Olfr832 A G 9: 18,944,746 T33A probably benign Het
P2rx1 G A 11: 73,010,030 V209M probably damaging Het
Pkn1 T C 8: 83,670,755 K874R possibly damaging Het
Plec C T 15: 76,172,376 V4444I probably damaging Het
Ppp1r37 A T 7: 19,532,404 M479K possibly damaging Het
Prr11 A C 11: 87,103,623 F66V probably benign Het
Rbbp5 A G 1: 132,496,816 D268G possibly damaging Het
Rbbp6 T A 7: 122,998,555 Y734* probably null Het
Rc3h2 GCC GCCC 2: 37,414,733 probably null Het
Rhou A G 8: 123,661,164 K212E probably benign Het
Rsph1 G A 17: 31,273,418 T58I probably benign Het
Serpina3m A G 12: 104,389,227 N51S probably damaging Het
Shisa6 A T 11: 66,218,006 D348E probably benign Het
Slc6a5 T A 7: 49,948,333 Y648* probably null Het
Stag3 A G 5: 138,299,843 D699G probably benign Het
Terf2ip A T 8: 112,018,017 D322V probably damaging Het
Vmn1r125 A T 7: 21,272,350 M58L probably benign Het
Wdr49 T A 3: 75,298,180 D643V probably damaging Het
Other mutations in Erlin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01387:Erlin2 APN 8 27036548 missense probably benign
IGL01534:Erlin2 APN 8 27031957 nonsense probably null
IGL02719:Erlin2 APN 8 27029675 unclassified probably benign
R0193:Erlin2 UTSW 8 27031764 missense possibly damaging 0.82
R4479:Erlin2 UTSW 8 27025099 missense probably benign 0.02
R4878:Erlin2 UTSW 8 27027166 splice site probably null
R4965:Erlin2 UTSW 8 27029595 missense probably damaging 0.99
R5082:Erlin2 UTSW 8 27033407 missense probably damaging 0.98
R5939:Erlin2 UTSW 8 27036526 missense probably benign 0.24
R6705:Erlin2 UTSW 8 27036440 missense probably damaging 1.00
R7033:Erlin2 UTSW 8 27031764 missense probably benign 0.03
R7537:Erlin2 UTSW 8 27031772 critical splice donor site probably null
R8161:Erlin2 UTSW 8 27028942 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGAAAGTGTCTTTGTTGGG -3'
(R):5'- AACAGTTTCCAGAGTTTTCCTGTTC -3'

Sequencing Primer
(F):5'- CAAGTGCTGTCTATACCACTGAG -3'
(R):5'- CCTGTTCAATACAAAATGAAGCTTC -3'
Posted On2017-10-10