Incidental Mutation 'R6172:Clpx'
ID488255
Institutional Source Beutler Lab
Gene Symbol Clpx
Ensembl Gene ENSMUSG00000015357
Gene Namecaseinolytic mitochondrial matrix peptidase chaperone subunit
Synonyms
MMRRC Submission 044315-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6172 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location65294260-65330658 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 65301879 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 92 (S92*)
Ref Sequence ENSEMBL: ENSMUSP00000109455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015501] [ENSMUST00000113824]
Predicted Effect probably null
Transcript: ENSMUST00000015501
AA Change: S92*
SMART Domains Protein: ENSMUSP00000015501
Gene: ENSMUSG00000015357
AA Change: S92*

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 81 101 N/A INTRINSIC
low complexity region 165 172 N/A INTRINSIC
PDB:4I9K|B 173 209 6e-7 PDB
low complexity region 259 268 N/A INTRINSIC
AAA 286 437 1.64e-12 SMART
low complexity region 452 458 N/A INTRINSIC
ClpB_D2-small 510 604 1.16e-29 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113824
AA Change: S92*
SMART Domains Protein: ENSMUSP00000109455
Gene: ENSMUSG00000015357
AA Change: S92*

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 81 101 N/A INTRINSIC
low complexity region 165 172 N/A INTRINSIC
low complexity region 245 254 N/A INTRINSIC
AAA 272 423 1.64e-12 SMART
low complexity region 438 444 N/A INTRINSIC
ClpB_D2-small 496 590 1.16e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155424
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a protease found in mitochondria. This protease is ATP-dependent and targets specific proteins for degradation. The protease consists of two heptameric rings of the CLPP catalytic subunit sandwiched between two hexameric rings of the chaperone subunit encoded by this gene. Targeted proteins are unwound by this protein and then passed on to the CLPP subunit for degradation. Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap42 A T 9: 9,148,245 C108S possibly damaging Het
Bbs2 T C 8: 94,087,411 E193G probably benign Het
Bpifb2 C A 2: 153,890,412 H310Q probably benign Het
Cand2 A G 6: 115,791,310 E472G probably benign Het
Cd81 A G 7: 143,052,954 probably benign Het
Chd5 A T 4: 152,379,391 H1476L probably damaging Het
Cstf3 T C 2: 104,651,642 V276A probably damaging Het
Ehd4 G A 2: 120,102,256 Q230* probably null Het
Erich3 A G 3: 154,764,341 T4A possibly damaging Het
Erlin2 T G 8: 27,036,095 probably null Het
Exosc1 C A 19: 41,924,003 Q148H probably damaging Het
Fbxw27 A T 9: 109,772,269 V261E probably damaging Het
Flrt2 T A 12: 95,779,531 N214K probably damaging Het
Foxp1 G A 6: 99,015,510 Q41* probably null Het
Foxp1 C A 6: 99,015,514 probably null Het
Frk T C 10: 34,591,965 L325P probably damaging Het
Gm21698 T C 5: 25,987,373 I72V probably benign Het
Gm39115 A T 7: 142,135,914 C41S unknown Het
Hectd1 G A 12: 51,769,282 P1336S probably damaging Het
Ighv7-1 T C 12: 113,896,563 S70G probably damaging Het
Itga10 T C 3: 96,647,437 I78T probably benign Het
Itgb4 A G 11: 116,000,411 H1218R probably benign Het
March6 A T 15: 31,482,867 N463K possibly damaging Het
Muc5b A C 7: 141,858,776 T1820P unknown Het
Nfatc4 A G 14: 55,829,533 T510A possibly damaging Het
Nwd2 G T 5: 63,806,906 V1278F probably damaging Het
Olfr668 A C 7: 104,925,296 M156R probably benign Het
Olfr832 A G 9: 18,944,746 T33A probably benign Het
P2rx1 G A 11: 73,010,030 V209M probably damaging Het
Pkn1 T C 8: 83,670,755 K874R possibly damaging Het
Plec C T 15: 76,172,376 V4444I probably damaging Het
Ppp1r37 A T 7: 19,532,404 M479K possibly damaging Het
Prr11 A C 11: 87,103,623 F66V probably benign Het
Rbbp5 A G 1: 132,496,816 D268G possibly damaging Het
Rbbp6 T A 7: 122,998,555 Y734* probably null Het
Rc3h2 GCC GCCC 2: 37,414,733 probably null Het
Rhou A G 8: 123,661,164 K212E probably benign Het
Rsph1 G A 17: 31,273,418 T58I probably benign Het
Serpina3m A G 12: 104,389,227 N51S probably damaging Het
Shisa6 A T 11: 66,218,006 D348E probably benign Het
Slc6a5 T A 7: 49,948,333 Y648* probably null Het
Stag3 A G 5: 138,299,843 D699G probably benign Het
Terf2ip A T 8: 112,018,017 D322V probably damaging Het
Vmn1r125 A T 7: 21,272,350 M58L probably benign Het
Wdr49 T A 3: 75,298,180 D643V probably damaging Het
Other mutations in Clpx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Clpx APN 9 65324270 missense probably damaging 1.00
IGL01394:Clpx APN 9 65310213 missense probably damaging 1.00
IGL01395:Clpx APN 9 65301851 missense probably benign 0.00
IGL01521:Clpx APN 9 65318744 missense probably damaging 1.00
IGL02141:Clpx APN 9 65312118 splice site probably null
IGL02512:Clpx APN 9 65310251 missense probably benign
IGL03008:Clpx APN 9 65322775 missense possibly damaging 0.76
IGL03146:Clpx APN 9 65326830 missense probably benign 0.01
IGL03152:Clpx APN 9 65310176 missense possibly damaging 0.56
IGL03309:Clpx APN 9 65322692 missense probably damaging 1.00
kneehigh UTSW 9 65301879 nonsense probably null
locust UTSW 9 65324301 critical splice donor site probably null
IGL02837:Clpx UTSW 9 65324259 missense probably damaging 1.00
R0167:Clpx UTSW 9 65316737 missense possibly damaging 0.53
R0399:Clpx UTSW 9 65322769 missense probably benign 0.03
R0666:Clpx UTSW 9 65310225 missense probably damaging 1.00
R1386:Clpx UTSW 9 65326888 missense probably null 0.88
R1594:Clpx UTSW 9 65324270 missense probably damaging 0.99
R2038:Clpx UTSW 9 65317493 missense probably damaging 1.00
R4131:Clpx UTSW 9 65316655 missense possibly damaging 0.64
R4715:Clpx UTSW 9 65312114 missense possibly damaging 0.92
R5107:Clpx UTSW 9 65308539 missense possibly damaging 0.93
R5248:Clpx UTSW 9 65320850 missense probably damaging 1.00
R5520:Clpx UTSW 9 65317448 nonsense probably null
R5639:Clpx UTSW 9 65329830 missense probably benign 0.00
R5718:Clpx UTSW 9 65299964 missense probably benign
R6109:Clpx UTSW 9 65299952 missense probably benign 0.02
R6173:Clpx UTSW 9 65301879 nonsense probably null
R6748:Clpx UTSW 9 65310159 missense probably benign 0.00
R7287:Clpx UTSW 9 65300013 nonsense probably null
R7409:Clpx UTSW 9 65324247 missense possibly damaging 0.94
R7806:Clpx UTSW 9 65299931 missense probably benign
R7814:Clpx UTSW 9 65324301 critical splice donor site probably null
R8212:Clpx UTSW 9 65320891 missense possibly damaging 0.46
R8753:Clpx UTSW 9 65316676 missense probably damaging 1.00
X0067:Clpx UTSW 9 65316695 missense possibly damaging 0.86
Z1177:Clpx UTSW 9 65299997 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGTAGATCTTATAACACCAGTGGC -3'
(R):5'- AGAGAATCACAATGTCCGGGC -3'

Sequencing Primer
(F):5'- TTATGCCACTGAGGACACTG -3'
(R):5'- TGTCCGGGCAAAAATAATTCTGG -3'
Posted On2017-10-10