Incidental Mutation 'R6172:Ighv7-1'
ID488265
Institutional Source Beutler Lab
Gene Symbol Ighv7-1
Ensembl Gene ENSMUSG00000076665
Gene Nameimmunoglobulin heavy variable 7-1
SynonymsGm16698
MMRRC Submission 044315-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6172 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location113896408-113896946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113896563 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 70 (S70G)
Ref Sequence ENSEMBL: ENSMUSP00000100255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103474]
Predicted Effect probably damaging
Transcript: ENSMUST00000103474
AA Change: S70G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000100255
Gene: ENSMUSG00000076665
AA Change: S70G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 36 119 6.1e-35 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap42 A T 9: 9,148,245 C108S possibly damaging Het
Bbs2 T C 8: 94,087,411 E193G probably benign Het
Bpifb2 C A 2: 153,890,412 H310Q probably benign Het
Cand2 A G 6: 115,791,310 E472G probably benign Het
Cd81 A G 7: 143,052,954 probably benign Het
Chd5 A T 4: 152,379,391 H1476L probably damaging Het
Clpx C A 9: 65,301,879 S92* probably null Het
Cstf3 T C 2: 104,651,642 V276A probably damaging Het
Ehd4 G A 2: 120,102,256 Q230* probably null Het
Erich3 A G 3: 154,764,341 T4A possibly damaging Het
Erlin2 T G 8: 27,036,095 probably null Het
Exosc1 C A 19: 41,924,003 Q148H probably damaging Het
Fbxw27 A T 9: 109,772,269 V261E probably damaging Het
Flrt2 T A 12: 95,779,531 N214K probably damaging Het
Foxp1 G A 6: 99,015,510 Q41* probably null Het
Foxp1 C A 6: 99,015,514 probably null Het
Frk T C 10: 34,591,965 L325P probably damaging Het
Gm21698 T C 5: 25,987,373 I72V probably benign Het
Gm39115 A T 7: 142,135,914 C41S unknown Het
Hectd1 G A 12: 51,769,282 P1336S probably damaging Het
Itga10 T C 3: 96,647,437 I78T probably benign Het
Itgb4 A G 11: 116,000,411 H1218R probably benign Het
March6 A T 15: 31,482,867 N463K possibly damaging Het
Muc5b A C 7: 141,858,776 T1820P unknown Het
Nfatc4 A G 14: 55,829,533 T510A possibly damaging Het
Nwd2 G T 5: 63,806,906 V1278F probably damaging Het
Olfr668 A C 7: 104,925,296 M156R probably benign Het
Olfr832 A G 9: 18,944,746 T33A probably benign Het
P2rx1 G A 11: 73,010,030 V209M probably damaging Het
Pkn1 T C 8: 83,670,755 K874R possibly damaging Het
Plec C T 15: 76,172,376 V4444I probably damaging Het
Ppp1r37 A T 7: 19,532,404 M479K possibly damaging Het
Prr11 A C 11: 87,103,623 F66V probably benign Het
Rbbp5 A G 1: 132,496,816 D268G possibly damaging Het
Rbbp6 T A 7: 122,998,555 Y734* probably null Het
Rc3h2 GCC GCCC 2: 37,414,733 probably null Het
Rhou A G 8: 123,661,164 K212E probably benign Het
Rsph1 G A 17: 31,273,418 T58I probably benign Het
Serpina3m A G 12: 104,389,227 N51S probably damaging Het
Shisa6 A T 11: 66,218,006 D348E probably benign Het
Slc6a5 T A 7: 49,948,333 Y648* probably null Het
Stag3 A G 5: 138,299,843 D699G probably benign Het
Terf2ip A T 8: 112,018,017 D322V probably damaging Het
Vmn1r125 A T 7: 21,272,350 M58L probably benign Het
Wdr49 T A 3: 75,298,180 D643V probably damaging Het
Other mutations in Ighv7-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Ighv7-1 APN 12 113896503 missense possibly damaging 0.78
IGL03006:Ighv7-1 APN 12 113896525 missense probably damaging 1.00
IGL03051:Ighv7-1 APN 12 113896956 unclassified probably benign
IGL03281:Ighv7-1 APN 12 113896951 unclassified probably benign
R3008:Ighv7-1 UTSW 12 113896451 missense probably damaging 1.00
R5754:Ighv7-1 UTSW 12 113896619 missense probably damaging 0.99
R6213:Ighv7-1 UTSW 12 113896521 missense probably damaging 0.99
R7324:Ighv7-1 UTSW 12 113896529 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCTGTTGGTCCAGAACAC -3'
(R):5'- TCTACTATTGCAGGTATCCAGTG -3'

Sequencing Primer
(F):5'- GAACACCCCTGCAATGAGGTTTG -3'
(R):5'- ACTATTGCAGGTATCCAGTGTGAGG -3'
Posted On2017-10-10