Mutagenetix > Incidental Mutation

Incidental Mutation 'R6135:Vps16'

488277

Institutional Source

Beutler Lab

Gene Symbol

Vps16

Ensembl Gene

ENSMUSG00000027411

Gene Name

VSP16 CORVET/HOPS core subunit

Synonyms

MMRRC Submission

044282-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.973) question?

Stock #

R6135 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

130424339-130444269 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 130438653 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 200 (Y200C)

Ref Sequence

ENSEMBL: ENSMUSP00000115899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000028900
AA Change: Y200C

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411
AA Change: Y200C

Domain	Start	End	E-Value	Type
Pfam:Vps16_N	4	420	1e-166	PFAM
low complexity region	452	462	N/A	INTRINSIC
Pfam:Vps16_C	517	835	5.5e-150	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125098

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125973

Predicted Effect

possibly damaging
Transcript: ENSMUST00000128994
AA Change: Y200C

PolyPhen 2 Score 0.569 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411
AA Change: Y200C

Domain	Start	End	E-Value	Type
Pfam:Vps16_N	4	212	3.2e-74	PFAM
Pfam:Vps16_N	205	316	1e-45	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130258

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131220

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132388

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134677

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137084

Meta Mutation Damage Score

0.6048

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.7%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	A	G	13: 77,254,216	E95G	probably damaging	Het
Abca4	C	T	3: 122,138,447	T250I	possibly damaging	Het
Ahi1	G	A	10: 20,969,121	R375H	probably benign	Het
Aimp1	T	C	3: 132,672,083	K174E	probably benign	Het
Aire	A	G	10: 78,042,967	L82P	probably damaging	Het
Akap13	T	A	7: 75,609,908	V760D	possibly damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Carf	C	T	1: 60,147,963	S540F	probably damaging	Het
Ccdc171	T	A	4: 83,554,850	M172K	probably benign	Het
Chpt1	A	T	10: 88,482,283	V199E	possibly damaging	Het
Cldn16	G	A	16: 26,474,268	D65N	possibly damaging	Het
Cnga3	G	A	1: 37,232,237		probably benign	Het
Col14a1	A	G	15: 55,380,850	T440A	unknown	Het
Creb3l3	A	G	10: 81,085,718	I331T	probably benign	Het
Cul9	T	C	17: 46,521,453	T1410A	probably benign	Het
Dnm1	T	A	2: 32,333,063		probably null	Het
Fhl5	A	T	4: 25,214,716	Y20*	probably null	Het
Fignl1	T	C	11: 11,802,557	D166G	probably benign	Het
Ghr	T	C	15: 3,325,965	I279V	probably benign	Het
Gm1979	T	G	5: 26,000,300	S180R	probably damaging	Het
Hydin	T	C	8: 110,462,660	V1232A	possibly damaging	Het
Ifnar1	A	G	16: 91,501,620		probably null	Het
Inpp5d	A	G	1: 87,620,397		probably null	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kcnh2	T	A	5: 24,321,793	S1002C	probably damaging	Het
Krt83	T	A	15: 101,487,534	E319V	probably damaging	Het
Lbp	A	G	2: 158,317,549	I201V	probably benign	Het
Man1a2	G	A	3: 100,684,932		probably benign	Het
Myh8	A	G	11: 67,297,500	T996A	possibly damaging	Het
Nat10	A	G	2: 103,743,316	L319P	probably damaging	Het
Nelfa	A	G	5: 33,899,276		probably null	Het
Olfr1447	A	C	19: 12,901,439	Y114D	probably damaging	Het
Pcdha11	T	A	18: 37,005,817	N166K	probably damaging	Het
Pcdha6	C	A	18: 36,969,216	N487K	probably damaging	Het
Pcsk2	A	G	2: 143,573,540	D91G	possibly damaging	Het
Pigp	A	G	16: 94,370,206	F22L	probably benign	Het
Pnpla8	A	C	12: 44,282,887	N74T	probably benign	Het
Ppargc1b	T	C	18: 61,315,909	K114R	probably damaging	Het
Ppfia2	A	G	10: 106,857,569	D645G	probably damaging	Het
Rnf213	G	A	11: 119,442,028	V2688I	probably benign	Het
Rnf43	A	G	11: 87,732,125	H557R	probably damaging	Het
Rp1l1	C	T	14: 64,030,096	P1044S	probably damaging	Het
Rrp9	G	A	9: 106,483,022	D210N	probably damaging	Het
Scin	G	T	12: 40,079,808	Q329K	possibly damaging	Het
Scn7a	T	A	2: 66,703,900	H477L	probably benign	Het
Slc26a8	A	T	17: 28,669,940	M195K	probably benign	Het
Spata13	A	G	14: 60,756,428	K1110E	probably damaging	Het
Spata24	T	A	18: 35,660,450	E103V	probably damaging	Het
Srek1	T	C	13: 103,774,386	N25S	probably damaging	Het
Strada	T	C	11: 106,173,314	Y59C	probably damaging	Het
Tnrc6c	T	C	11: 117,736,005	W1143R	probably damaging	Het
Trip12	A	T	1: 84,760,838	D765E	probably benign	Het
Ttbk2	G	A	2: 120,750,317	R444C	probably damaging	Het
Ush2a	T	A	1: 188,912,106	I4555N	possibly damaging	Het
Vcan	C	T	13: 89,689,926	E2500K	probably benign	Het
Wdfy4	T	A	14: 32,971,711	H2719L	probably damaging	Het
Zfhx2	T	C	14: 55,074,196	D347G	possibly damaging	Het
Zfp653	G	A	9: 22,058,262	T236I	probably damaging	Het
Zscan4-ps1	A	T	7: 11,065,986	H325Q	probably benign	Het

Other mutations in Vps16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:Vps16	APN	2	130437696	missense	probably benign	0.19
IGL01400:Vps16	APN	2	130438353	missense	possibly damaging	0.73
IGL01542:Vps16	APN	2	130438394	missense	probably damaging	0.97
IGL02011:Vps16	APN	2	130441479	missense	probably benign	0.04
IGL02192:Vps16	APN	2	130440932	missense	probably damaging	0.98
IGL02220:Vps16	APN	2	130441653	missense	possibly damaging	0.85
IGL02587:Vps16	APN	2	130439716	critical splice donor site	probably null
R0427:Vps16	UTSW	2	130438850	missense	probably benign	0.00
R0507:Vps16	UTSW	2	130437712	critical splice donor site	probably null
R1550:Vps16	UTSW	2	130440340	missense	probably benign	0.09
R1789:Vps16	UTSW	2	130443600	missense	probably benign	0.42
R3895:Vps16	UTSW	2	130438676	missense	possibly damaging	0.96
R3981:Vps16	UTSW	2	130442594	missense	possibly damaging	0.77
R4092:Vps16	UTSW	2	130439912	missense	probably damaging	1.00
R4555:Vps16	UTSW	2	130443576	missense	probably damaging	1.00
R4569:Vps16	UTSW	2	130442204	missense	probably benign
R4803:Vps16	UTSW	2	130438110	missense	probably benign	0.27
R4835:Vps16	UTSW	2	130438300	splice site	probably benign
R5022:Vps16	UTSW	2	130439452	missense	probably benign	0.07
R5023:Vps16	UTSW	2	130439452	missense	probably benign	0.07
R5057:Vps16	UTSW	2	130439452	missense	probably benign	0.07
R5158:Vps16	UTSW	2	130441279	missense	probably damaging	1.00
R5177:Vps16	UTSW	2	130443368	nonsense	probably null
R5540:Vps16	UTSW	2	130442385	missense	probably benign	0.00
R5680:Vps16	UTSW	2	130440324	missense	possibly damaging	0.64
R5689:Vps16	UTSW	2	130439091	nonsense	probably null
R5690:Vps16	UTSW	2	130439091	nonsense	probably null
R5926:Vps16	UTSW	2	130443556	missense	probably damaging	0.97
R5992:Vps16	UTSW	2	130424449	critical splice donor site	probably null
R6370:Vps16	UTSW	2	130443384	missense	probably damaging	1.00
R6898:Vps16	UTSW	2	130437681	missense	possibly damaging	0.74
R7378:Vps16	UTSW	2	130438179	missense	probably damaging	1.00
R7487:Vps16	UTSW	2	130439057	nonsense	probably null
R7641:Vps16	UTSW	2	130440528	missense	probably benign	0.28
R7720:Vps16	UTSW	2	130441703	nonsense	probably null
R8246:Vps16	UTSW	2	130438873	missense	probably damaging	1.00
R8363:Vps16	UTSW	2	130442241	missense	probably benign	0.08
R9092:Vps16	UTSW	2	130439673	missense	probably damaging	0.99
R9128:Vps16	UTSW	2	130424399	missense	possibly damaging	0.51
R9352:Vps16	UTSW	2	130441903	critical splice donor site	probably null
R9406:Vps16	UTSW	2	130441505	critical splice donor site	probably null
R9508:Vps16	UTSW	2	130442441	missense	possibly damaging	0.94
R9800:Vps16	UTSW	2	130440485	missense	probably benign	0.02
RF021:Vps16	UTSW	2	130438209	missense	probably benign	0.09
Z1177:Vps16	UTSW	2	130441426	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACGGATATGCTTCCAGACTG -3'
(R):5'- CATCCAGATGTAGCCTGTGTC -3'

Sequencing Primer
(F):5'- CTGGAACCAGCAGAGACAC -3'
(R):5'- TACGTGAAGGATACAGCCATCTG -3'

Posted On

2017-10-10