Incidental Mutation 'R6135:Pcsk2'
ID488278
Institutional Source Beutler Lab
Gene Symbol Pcsk2
Ensembl Gene ENSMUSG00000027419
Gene Nameproprotein convertase subtilisin/kexin type 2
SynonymsPhpp-2, SPC2, Nec2, PC2, Nec-2, prohormone convertase 2, 6330411F23Rik
MMRRC Submission 044282-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R6135 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location143546156-143816285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143573540 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 91 (D91G)
Ref Sequence ENSEMBL: ENSMUSP00000028905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028905]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028905
AA Change: D91G

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028905
Gene: ENSMUSG00000027419
AA Change: D91G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:S8_pro-domain 32 108 2.9e-21 PFAM
Pfam:Peptidase_S8 157 444 5e-44 PFAM
Pfam:P_proprotein 503 590 4.3e-28 PFAM
low complexity region 617 630 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124751
Meta Mutation Damage Score 0.2311 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The protein undergoes an initial autocatalytic processing event and interacts with a neuroendocrine secretory protein in the ER, exits the ER and sorts to secretory granules, where it is cleaved and catalytically activated during intracellular transport. The encoded protease is packaged into and activated in dense core secretory granules and expressed in the neuroendocrine system and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It functions in the proteolytic activation of polypeptide hormones and neuropeptides precursors. Single nucleotide polymorphisms in this gene may increase susceptibility to myocardial infarction and type 2 diabetes. This gene may also play a role in tumor development and progression. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruptions of this gene display abnormalities in the maturation of peptide hormones leading to reduced female fertility, increased blood pressure on a high salt diet, and abnormal glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,254,216 E95G probably damaging Het
Abca4 C T 3: 122,138,447 T250I possibly damaging Het
Ahi1 G A 10: 20,969,121 R375H probably benign Het
Aimp1 T C 3: 132,672,083 K174E probably benign Het
Aire A G 10: 78,042,967 L82P probably damaging Het
Akap13 T A 7: 75,609,908 V760D possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Carf C T 1: 60,147,963 S540F probably damaging Het
Ccdc171 T A 4: 83,554,850 M172K probably benign Het
Chpt1 A T 10: 88,482,283 V199E possibly damaging Het
Cldn16 G A 16: 26,474,268 D65N possibly damaging Het
Cnga3 G A 1: 37,232,237 probably benign Het
Col14a1 A G 15: 55,380,850 T440A unknown Het
Creb3l3 A G 10: 81,085,718 I331T probably benign Het
Cul9 T C 17: 46,521,453 T1410A probably benign Het
Dnm1 T A 2: 32,333,063 probably null Het
Fhl5 A T 4: 25,214,716 Y20* probably null Het
Fignl1 T C 11: 11,802,557 D166G probably benign Het
Ghr T C 15: 3,325,965 I279V probably benign Het
Gm1979 T G 5: 26,000,300 S180R probably damaging Het
Hydin T C 8: 110,462,660 V1232A possibly damaging Het
Ifnar1 A G 16: 91,501,620 probably null Het
Inpp5d A G 1: 87,620,397 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnh2 T A 5: 24,321,793 S1002C probably damaging Het
Krt83 T A 15: 101,487,534 E319V probably damaging Het
Lbp A G 2: 158,317,549 I201V probably benign Het
Man1a2 G A 3: 100,684,932 probably benign Het
Myh8 A G 11: 67,297,500 T996A possibly damaging Het
Nat10 A G 2: 103,743,316 L319P probably damaging Het
Nelfa A G 5: 33,899,276 probably null Het
Olfr1447 A C 19: 12,901,439 Y114D probably damaging Het
Pcdha11 T A 18: 37,005,817 N166K probably damaging Het
Pcdha6 C A 18: 36,969,216 N487K probably damaging Het
Pigp A G 16: 94,370,206 F22L probably benign Het
Pnpla8 A C 12: 44,282,887 N74T probably benign Het
Ppargc1b T C 18: 61,315,909 K114R probably damaging Het
Ppfia2 A G 10: 106,857,569 D645G probably damaging Het
Rnf213 G A 11: 119,442,028 V2688I probably benign Het
Rnf43 A G 11: 87,732,125 H557R probably damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
Rrp9 G A 9: 106,483,022 D210N probably damaging Het
Scin G T 12: 40,079,808 Q329K possibly damaging Het
Scn7a T A 2: 66,703,900 H477L probably benign Het
Slc26a8 A T 17: 28,669,940 M195K probably benign Het
Spata13 A G 14: 60,756,428 K1110E probably damaging Het
Spata24 T A 18: 35,660,450 E103V probably damaging Het
Srek1 T C 13: 103,774,386 N25S probably damaging Het
Strada T C 11: 106,173,314 Y59C probably damaging Het
Tnrc6c T C 11: 117,736,005 W1143R probably damaging Het
Trip12 A T 1: 84,760,838 D765E probably benign Het
Ttbk2 G A 2: 120,750,317 R444C probably damaging Het
Ush2a T A 1: 188,912,106 I4555N possibly damaging Het
Vcan C T 13: 89,689,926 E2500K probably benign Het
Vps16 A G 2: 130,438,653 Y200C possibly damaging Het
Wdfy4 T A 14: 32,971,711 H2719L probably damaging Het
Zfhx2 T C 14: 55,074,196 D347G possibly damaging Het
Zfp653 G A 9: 22,058,262 T236I probably damaging Het
Zscan4-ps1 A T 7: 11,065,986 H325Q probably benign Het
Other mutations in Pcsk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Pcsk2 APN 2 143793239 missense probably damaging 1.00
IGL01609:Pcsk2 APN 2 143801158 missense possibly damaging 0.88
IGL01690:Pcsk2 APN 2 143687570 missense probably benign
IGL01833:Pcsk2 APN 2 143687580 missense possibly damaging 0.62
IGL01962:Pcsk2 APN 2 143813632 nonsense probably null
IGL02219:Pcsk2 APN 2 143793125 missense probably damaging 1.00
IGL02572:Pcsk2 APN 2 143690342 missense probably damaging 1.00
IGL02752:Pcsk2 APN 2 143773945 missense probably benign 0.09
P0035:Pcsk2 UTSW 2 143795951 missense probably damaging 1.00
R0092:Pcsk2 UTSW 2 143801024 missense probably damaging 1.00
R1424:Pcsk2 UTSW 2 143573428 splice site probably benign
R1470:Pcsk2 UTSW 2 143546518 nonsense probably null
R1470:Pcsk2 UTSW 2 143546518 nonsense probably null
R1832:Pcsk2 UTSW 2 143793269 missense probably damaging 1.00
R1993:Pcsk2 UTSW 2 143687619 missense probably benign 0.00
R4615:Pcsk2 UTSW 2 143795969 missense probably damaging 1.00
R4783:Pcsk2 UTSW 2 143687679 critical splice donor site probably null
R4796:Pcsk2 UTSW 2 143813425 missense probably benign 0.16
R4827:Pcsk2 UTSW 2 143801179 nonsense probably null
R5357:Pcsk2 UTSW 2 143573464 missense probably benign 0.00
R5413:Pcsk2 UTSW 2 143696700 splice site probably null
R5440:Pcsk2 UTSW 2 143546543 missense probably benign 0.22
R5546:Pcsk2 UTSW 2 143546560 missense probably benign 0.00
R5605:Pcsk2 UTSW 2 143749245 intron probably benign
R5821:Pcsk2 UTSW 2 143749115 splice site probably null
R5905:Pcsk2 UTSW 2 143749140 missense probably damaging 0.98
R6120:Pcsk2 UTSW 2 143801111 missense probably damaging 1.00
R6657:Pcsk2 UTSW 2 143690366 missense probably damaging 1.00
R6925:Pcsk2 UTSW 2 143813747 missense probably damaging 1.00
R7223:Pcsk2 UTSW 2 143690333 missense possibly damaging 0.95
R7289:Pcsk2 UTSW 2 143690423 missense probably damaging 1.00
R8043:Pcsk2 UTSW 2 143813530 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACAGTTCCTGCTCACGTGG -3'
(R):5'- GCAAAGCACCTGTGTTTTCTCC -3'

Sequencing Primer
(F):5'- GTGGTTCTATCCTGGTGCCAAC -3'
(R):5'- TTTTCTCCTGCATCCATATACATATG -3'
Posted On2017-10-10