Incidental Mutation 'R6135:Fhl5'
ID488283
Institutional Source Beutler Lab
Gene Symbol Fhl5
Ensembl Gene ENSMUSG00000028259
Gene Namefour and a half LIM domains 5
SynonymsACT, 1700027G07Rik
MMRRC Submission 044282-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6135 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location25199908-25242876 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 25214716 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 20 (Y20*)
Ref Sequence ENSEMBL: ENSMUSP00000103839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029922] [ENSMUST00000108204]
Predicted Effect probably null
Transcript: ENSMUST00000029922
AA Change: Y20*
SMART Domains Protein: ENSMUSP00000029922
Gene: ENSMUSG00000028259
AA Change: Y20*

DomainStartEndE-ValueType
LIM 40 93 1.91e-11 SMART
LIM 101 154 4.59e-14 SMART
LIM 162 213 3.7e-9 SMART
LIM 221 276 7.68e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108204
AA Change: Y20*
SMART Domains Protein: ENSMUSP00000103839
Gene: ENSMUSG00000028259
AA Change: Y20*

DomainStartEndE-ValueType
LIM 40 93 1.91e-11 SMART
LIM 101 154 4.59e-14 SMART
LIM 162 213 3.7e-9 SMART
LIM 221 276 7.68e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124792
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is coordinately expressed with activator of cAMP-responsive element modulator (CREM). It is associated with CREM and confers a powerful transcriptional activation function. CREM acts as a transcription factor essential for the differentiation of spermatids into mature spermatozoa. There are multiple polyadenylation sites found in this gene. Polymorphisms in this gene may be associated with susceptibility for migraine headaches. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Apr 2016]
PHENOTYPE: Male mice homozygous for disruptions of this gene have reduced sperm counts and abnormal sperm but are none the less fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,254,216 E95G probably damaging Het
Abca4 C T 3: 122,138,447 T250I possibly damaging Het
Ahi1 G A 10: 20,969,121 R375H probably benign Het
Aimp1 T C 3: 132,672,083 K174E probably benign Het
Aire A G 10: 78,042,967 L82P probably damaging Het
Akap13 T A 7: 75,609,908 V760D possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Carf C T 1: 60,147,963 S540F probably damaging Het
Ccdc171 T A 4: 83,554,850 M172K probably benign Het
Chpt1 A T 10: 88,482,283 V199E possibly damaging Het
Cldn16 G A 16: 26,474,268 D65N possibly damaging Het
Cnga3 G A 1: 37,232,237 probably benign Het
Col14a1 A G 15: 55,380,850 T440A unknown Het
Creb3l3 A G 10: 81,085,718 I331T probably benign Het
Cul9 T C 17: 46,521,453 T1410A probably benign Het
Dnm1 T A 2: 32,333,063 probably null Het
Fignl1 T C 11: 11,802,557 D166G probably benign Het
Ghr T C 15: 3,325,965 I279V probably benign Het
Gm1979 T G 5: 26,000,300 S180R probably damaging Het
Hydin T C 8: 110,462,660 V1232A possibly damaging Het
Ifnar1 A G 16: 91,501,620 probably null Het
Inpp5d A G 1: 87,620,397 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnh2 T A 5: 24,321,793 S1002C probably damaging Het
Krt83 T A 15: 101,487,534 E319V probably damaging Het
Lbp A G 2: 158,317,549 I201V probably benign Het
Man1a2 G A 3: 100,684,932 probably benign Het
Myh8 A G 11: 67,297,500 T996A possibly damaging Het
Nat10 A G 2: 103,743,316 L319P probably damaging Het
Nelfa A G 5: 33,899,276 probably null Het
Olfr1447 A C 19: 12,901,439 Y114D probably damaging Het
Pcdha11 T A 18: 37,005,817 N166K probably damaging Het
Pcdha6 C A 18: 36,969,216 N487K probably damaging Het
Pcsk2 A G 2: 143,573,540 D91G possibly damaging Het
Pigp A G 16: 94,370,206 F22L probably benign Het
Pnpla8 A C 12: 44,282,887 N74T probably benign Het
Ppargc1b T C 18: 61,315,909 K114R probably damaging Het
Ppfia2 A G 10: 106,857,569 D645G probably damaging Het
Rnf213 G A 11: 119,442,028 V2688I probably benign Het
Rnf43 A G 11: 87,732,125 H557R probably damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
Rrp9 G A 9: 106,483,022 D210N probably damaging Het
Scin G T 12: 40,079,808 Q329K possibly damaging Het
Scn7a T A 2: 66,703,900 H477L probably benign Het
Slc26a8 A T 17: 28,669,940 M195K probably benign Het
Spata13 A G 14: 60,756,428 K1110E probably damaging Het
Spata24 T A 18: 35,660,450 E103V probably damaging Het
Srek1 T C 13: 103,774,386 N25S probably damaging Het
Strada T C 11: 106,173,314 Y59C probably damaging Het
Tnrc6c T C 11: 117,736,005 W1143R probably damaging Het
Trip12 A T 1: 84,760,838 D765E probably benign Het
Ttbk2 G A 2: 120,750,317 R444C probably damaging Het
Ush2a T A 1: 188,912,106 I4555N possibly damaging Het
Vcan C T 13: 89,689,926 E2500K probably benign Het
Vps16 A G 2: 130,438,653 Y200C possibly damaging Het
Wdfy4 T A 14: 32,971,711 H2719L probably damaging Het
Zfhx2 T C 14: 55,074,196 D347G possibly damaging Het
Zfp653 G A 9: 22,058,262 T236I probably damaging Het
Zscan4-ps1 A T 7: 11,065,986 H325Q probably benign Het
Other mutations in Fhl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Fhl5 APN 4 25207181 missense possibly damaging 0.95
IGL02194:Fhl5 APN 4 25211341 missense probably benign 0.01
IGL03172:Fhl5 APN 4 25211309 missense probably damaging 1.00
PIT4466001:Fhl5 UTSW 4 25211194 missense probably damaging 1.00
PIT4472001:Fhl5 UTSW 4 25211194 missense probably damaging 1.00
R0020:Fhl5 UTSW 4 25200054 missense probably benign 0.15
R0020:Fhl5 UTSW 4 25200054 missense probably benign 0.15
R0256:Fhl5 UTSW 4 25213624 missense probably benign
R0304:Fhl5 UTSW 4 25207241 missense probably benign 0.01
R0480:Fhl5 UTSW 4 25207101 nonsense probably null
R0563:Fhl5 UTSW 4 25213610 missense probably damaging 0.96
R3418:Fhl5 UTSW 4 25211252 missense probably benign
R3926:Fhl5 UTSW 4 25214790 splice site probably benign
R4382:Fhl5 UTSW 4 25200118 missense probably benign 0.16
R5930:Fhl5 UTSW 4 25214756 missense probably benign 0.04
R6927:Fhl5 UTSW 4 25213681 missense probably benign 0.14
R7147:Fhl5 UTSW 4 25213777 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCTTACACTGTAGAAAACGTGGG -3'
(R):5'- CAAGCAGCTCCCTAAATTTGTG -3'

Sequencing Primer
(F):5'- CACTGTAGAAAACGTGGGTAAAAGTC -3'
(R):5'- GACACTATGTAATGTACAAAGTC -3'
Posted On2017-10-10