Incidental Mutation 'R6135:Rrp9'
ID488291
Institutional Source Beutler Lab
Gene Symbol Rrp9
Ensembl Gene ENSMUSG00000041506
Gene NameRRP9, small subunit (SSU) processome component, homolog (yeast)
SynonymsRnu3ip2, U3-55k, 55kDa, D9Wsu10e
MMRRC Submission 044282-MU
Accession Numbers

NCBI RefSeq: NM_145620.4; MGI: 2384313

Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R6135 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location106475963-106485424 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106483022 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 210 (D210N)
Ref Sequence ENSEMBL: ENSMUSP00000038580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047721] [ENSMUST00000185336]
Predicted Effect probably damaging
Transcript: ENSMUST00000047721
AA Change: D210N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038580
Gene: ENSMUSG00000041506
AA Change: D210N

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
low complexity region 47 57 N/A INTRINSIC
coiled coil region 61 102 N/A INTRINSIC
WD40 135 174 1.15e-4 SMART
WD40 177 227 3.09e-5 SMART
WD40 230 269 2.42e-7 SMART
WD40 272 311 9.24e-4 SMART
WD40 313 351 2.4e-2 SMART
WD40 354 404 4.6e0 SMART
Blast:WD40 412 451 1e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131618
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156796
Predicted Effect probably benign
Transcript: ENSMUST00000185336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217303
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD-repeat protein family. The encoded protein is a component of the nucleolar small nuclear ribonucleoprotein particle (snoRNP) and is essential for 18s rRNA processing during ribosome synthesis. It contains seven WD domains required for nucleolar localization and specific interaction with the U3 small nucleolar RNA (U3 snoRNA). [provided by RefSeq, Oct 2012]
Allele List at MGI

All alleles(3) : Targeted(1) Gene trapped(2)  

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,254,216 E95G probably damaging Het
Abca4 C T 3: 122,138,447 T250I possibly damaging Het
Ahi1 G A 10: 20,969,121 R375H probably benign Het
Aimp1 T C 3: 132,672,083 K174E probably benign Het
Aire A G 10: 78,042,967 L82P probably damaging Het
Akap13 T A 7: 75,609,908 V760D possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Carf C T 1: 60,147,963 S540F probably damaging Het
Ccdc171 T A 4: 83,554,850 M172K probably benign Het
Chpt1 A T 10: 88,482,283 V199E possibly damaging Het
Cldn16 G A 16: 26,474,268 D65N possibly damaging Het
Cnga3 G A 1: 37,232,237 probably benign Het
Col14a1 A G 15: 55,380,850 T440A unknown Het
Creb3l3 A G 10: 81,085,718 I331T probably benign Het
Cul9 T C 17: 46,521,453 T1410A probably benign Het
Dnm1 T A 2: 32,333,063 probably null Het
Fhl5 A T 4: 25,214,716 Y20* probably null Het
Fignl1 T C 11: 11,802,557 D166G probably benign Het
Ghr T C 15: 3,325,965 I279V probably benign Het
Gm1979 T G 5: 26,000,300 S180R probably damaging Het
Hydin T C 8: 110,462,660 V1232A possibly damaging Het
Ifnar1 A G 16: 91,501,620 probably null Het
Inpp5d A G 1: 87,620,397 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnh2 T A 5: 24,321,793 S1002C probably damaging Het
Krt83 T A 15: 101,487,534 E319V probably damaging Het
Lbp A G 2: 158,317,549 I201V probably benign Het
Man1a2 G A 3: 100,684,932 probably benign Het
Myh8 A G 11: 67,297,500 T996A possibly damaging Het
Nat10 A G 2: 103,743,316 L319P probably damaging Het
Nelfa A G 5: 33,899,276 probably null Het
Olfr1447 A C 19: 12,901,439 Y114D probably damaging Het
Pcdha11 T A 18: 37,005,817 N166K probably damaging Het
Pcdha6 C A 18: 36,969,216 N487K probably damaging Het
Pcsk2 A G 2: 143,573,540 D91G possibly damaging Het
Pigp A G 16: 94,370,206 F22L probably benign Het
Pnpla8 A C 12: 44,282,887 N74T probably benign Het
Ppargc1b T C 18: 61,315,909 K114R probably damaging Het
Ppfia2 A G 10: 106,857,569 D645G probably damaging Het
Rnf213 G A 11: 119,442,028 V2688I probably benign Het
Rnf43 A G 11: 87,732,125 H557R probably damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
Scin G T 12: 40,079,808 Q329K possibly damaging Het
Scn7a T A 2: 66,703,900 H477L probably benign Het
Slc26a8 A T 17: 28,669,940 M195K probably benign Het
Spata13 A G 14: 60,756,428 K1110E probably damaging Het
Spata24 T A 18: 35,660,450 E103V probably damaging Het
Srek1 T C 13: 103,774,386 N25S probably damaging Het
Strada T C 11: 106,173,314 Y59C probably damaging Het
Tnrc6c T C 11: 117,736,005 W1143R probably damaging Het
Trip12 A T 1: 84,760,838 D765E probably benign Het
Ttbk2 G A 2: 120,750,317 R444C probably damaging Het
Ush2a T A 1: 188,912,106 I4555N possibly damaging Het
Vcan C T 13: 89,689,926 E2500K probably benign Het
Vps16 A G 2: 130,438,653 Y200C possibly damaging Het
Wdfy4 T A 14: 32,971,711 H2719L probably damaging Het
Zfhx2 T C 14: 55,074,196 D347G possibly damaging Het
Zfp653 G A 9: 22,058,262 T236I probably damaging Het
Zscan4-ps1 A T 7: 11,065,986 H325Q probably benign Het
Other mutations in Rrp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02383:Rrp9 APN 9 106485272 missense probably damaging 0.99
IGL02540:Rrp9 APN 9 106483547 unclassified probably benign
IGL02581:Rrp9 APN 9 106483628 missense probably damaging 1.00
P0005:Rrp9 UTSW 9 106481177 missense probably benign
R1757:Rrp9 UTSW 9 106483004 missense probably damaging 0.99
R5585:Rrp9 UTSW 9 106485326 missense probably benign 0.35
R6437:Rrp9 UTSW 9 106482951 missense probably benign 0.34
R6575:Rrp9 UTSW 9 106483579 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACAAAGTGACAAGTACAGATGCTC -3'
(R):5'- TGTCCCGTGAAGGTGTACAG -3'

Sequencing Primer
(F):5'- AGATGCTCACAGCTGCTGAG -3'
(R):5'- TGTACAGGTGCTGGCAGC -3'
Posted On2017-10-10