Incidental Mutation 'R6135:Creb3l3'
ID488295
Institutional Source Beutler Lab
Gene Symbol Creb3l3
Ensembl Gene ENSMUSG00000035041
Gene NamecAMP responsive element binding protein 3-like 3
SynonymsD10Bur1e, CREB-H
MMRRC Submission 044282-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6135 (G1)
Quality Score147.008
Status Validated
Chromosome10
Chromosomal Location81084324-81098874 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81085718 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 331 (I331T)
Ref Sequence ENSEMBL: ENSMUSP00000112836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005057] [ENSMUST00000117422]
Predicted Effect probably benign
Transcript: ENSMUST00000005057
SMART Domains Protein: ENSMUSP00000005057
Gene: ENSMUSG00000004929

DomainStartEndE-ValueType
Pfam:Peptidase_M3 227 677 7e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117422
AA Change: I331T

PolyPhen 2 Score 0.203 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112836
Gene: ENSMUSG00000035041
AA Change: I331T

DomainStartEndE-ValueType
low complexity region 179 199 N/A INTRINSIC
BRLZ 237 301 4.36e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143969
Meta Mutation Damage Score 0.1794 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic-leucine zipper family and the AMP-dependent transcription factor family. The encoded protein is localized to the endoplasmic reticulum and acts as a transcription factor activated by cyclic AMP stimulation. The encoded protein binds the cyclic AMP response element (CRE) and the box-B element and has been linked to acute inflammatory response, hepatocellular carcinoma, triglyceride metabolism, and hepcidin expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and healthy but exhibit reduced expression of acute phase response proteins following treatment with tunicamycin that induces ER stress. Mice homozygous for a different knock-out allele exhibit resistanceto sulpyrine-induced shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,254,216 E95G probably damaging Het
Abca4 C T 3: 122,138,447 T250I possibly damaging Het
Ahi1 G A 10: 20,969,121 R375H probably benign Het
Aimp1 T C 3: 132,672,083 K174E probably benign Het
Aire A G 10: 78,042,967 L82P probably damaging Het
Akap13 T A 7: 75,609,908 V760D possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Carf C T 1: 60,147,963 S540F probably damaging Het
Ccdc171 T A 4: 83,554,850 M172K probably benign Het
Chpt1 A T 10: 88,482,283 V199E possibly damaging Het
Cldn16 G A 16: 26,474,268 D65N possibly damaging Het
Cnga3 G A 1: 37,232,237 probably benign Het
Col14a1 A G 15: 55,380,850 T440A unknown Het
Cul9 T C 17: 46,521,453 T1410A probably benign Het
Dnm1 T A 2: 32,333,063 probably null Het
Fhl5 A T 4: 25,214,716 Y20* probably null Het
Fignl1 T C 11: 11,802,557 D166G probably benign Het
Ghr T C 15: 3,325,965 I279V probably benign Het
Gm1979 T G 5: 26,000,300 S180R probably damaging Het
Hydin T C 8: 110,462,660 V1232A possibly damaging Het
Ifnar1 A G 16: 91,501,620 probably null Het
Inpp5d A G 1: 87,620,397 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnh2 T A 5: 24,321,793 S1002C probably damaging Het
Krt83 T A 15: 101,487,534 E319V probably damaging Het
Lbp A G 2: 158,317,549 I201V probably benign Het
Man1a2 G A 3: 100,684,932 probably benign Het
Myh8 A G 11: 67,297,500 T996A possibly damaging Het
Nat10 A G 2: 103,743,316 L319P probably damaging Het
Nelfa A G 5: 33,899,276 probably null Het
Olfr1447 A C 19: 12,901,439 Y114D probably damaging Het
Pcdha11 T A 18: 37,005,817 N166K probably damaging Het
Pcdha6 C A 18: 36,969,216 N487K probably damaging Het
Pcsk2 A G 2: 143,573,540 D91G possibly damaging Het
Pigp A G 16: 94,370,206 F22L probably benign Het
Pnpla8 A C 12: 44,282,887 N74T probably benign Het
Ppargc1b T C 18: 61,315,909 K114R probably damaging Het
Ppfia2 A G 10: 106,857,569 D645G probably damaging Het
Rnf213 G A 11: 119,442,028 V2688I probably benign Het
Rnf43 A G 11: 87,732,125 H557R probably damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
Rrp9 G A 9: 106,483,022 D210N probably damaging Het
Scin G T 12: 40,079,808 Q329K possibly damaging Het
Scn7a T A 2: 66,703,900 H477L probably benign Het
Slc26a8 A T 17: 28,669,940 M195K probably benign Het
Spata13 A G 14: 60,756,428 K1110E probably damaging Het
Spata24 T A 18: 35,660,450 E103V probably damaging Het
Srek1 T C 13: 103,774,386 N25S probably damaging Het
Strada T C 11: 106,173,314 Y59C probably damaging Het
Tnrc6c T C 11: 117,736,005 W1143R probably damaging Het
Trip12 A T 1: 84,760,838 D765E probably benign Het
Ttbk2 G A 2: 120,750,317 R444C probably damaging Het
Ush2a T A 1: 188,912,106 I4555N possibly damaging Het
Vcan C T 13: 89,689,926 E2500K probably benign Het
Vps16 A G 2: 130,438,653 Y200C possibly damaging Het
Wdfy4 T A 14: 32,971,711 H2719L probably damaging Het
Zfhx2 T C 14: 55,074,196 D347G possibly damaging Het
Zfp653 G A 9: 22,058,262 T236I probably damaging Het
Zscan4-ps1 A T 7: 11,065,986 H325Q probably benign Het
Other mutations in Creb3l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01387:Creb3l3 APN 10 81091276 missense probably benign
IGL02651:Creb3l3 APN 10 81084834 missense probably benign 0.03
IGL03093:Creb3l3 APN 10 81091213 missense probably benign 0.00
PIT4382001:Creb3l3 UTSW 10 81084912 missense probably benign 0.01
R0501:Creb3l3 UTSW 10 81086582 missense probably benign 0.29
R2421:Creb3l3 UTSW 10 81091818 missense probably benign 0.01
R2567:Creb3l3 UTSW 10 81086049 missense probably benign 0.00
R4038:Creb3l3 UTSW 10 81089338 missense probably benign 0.15
R4748:Creb3l3 UTSW 10 81086047 missense probably benign 0.00
R5596:Creb3l3 UTSW 10 81085047 missense probably benign 0.01
R5814:Creb3l3 UTSW 10 81085662 missense probably benign 0.01
R5889:Creb3l3 UTSW 10 81092533 utr 5 prime probably benign
R6299:Creb3l3 UTSW 10 81088613 missense probably damaging 1.00
R6721:Creb3l3 UTSW 10 81091143 missense probably damaging 0.96
R7472:Creb3l3 UTSW 10 81089467 intron probably null
R7761:Creb3l3 UTSW 10 81084999 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AGTCTCCTGATATGGTATGGGC -3'
(R):5'- CAAGTTACAAGTCAGCCTGGC -3'

Sequencing Primer
(F):5'- GGATAGCTCTGAAGTAATCCCCTG -3'
(R):5'- GTTACAAGTCAGCCTGGCTATAAAG -3'
Posted On2017-10-10