Incidental Mutation 'R6135:Pnpla8'
ID488306
Institutional Source Beutler Lab
Gene Symbol Pnpla8
Ensembl Gene ENSMUSG00000036257
Gene Namepatatin-like phospholipase domain containing 8
Synonyms1200006O19Rik, iPLA2 gamma
MMRRC Submission 044282-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R6135 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location44221370-44322532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 44282887 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 74 (N74T)
Ref Sequence ENSEMBL: ENSMUSP00000122560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043082] [ENSMUST00000122902] [ENSMUST00000125757] [ENSMUST00000143771] [ENSMUST00000218954]
Predicted Effect probably benign
Transcript: ENSMUST00000043082
AA Change: N74T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000043286
Gene: ENSMUSG00000036257
AA Change: N74T

DomainStartEndE-ValueType
SCOP:d1gw5a_ 332 430 2e-3 SMART
Pfam:Patatin 439 634 1.4e-26 PFAM
low complexity region 664 675 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122902
SMART Domains Protein: ENSMUSP00000120877
Gene: ENSMUSG00000036257

DomainStartEndE-ValueType
SCOP:d1gw5a_ 114 212 2e-3 SMART
Pfam:Patatin 221 416 3e-27 PFAM
low complexity region 446 457 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125757
AA Change: N74T

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000143771
AA Change: N74T

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000122560
Gene: ENSMUSG00000036257
AA Change: N74T

DomainStartEndE-ValueType
SCOP:d1gw5a_ 332 430 3e-3 SMART
Pfam:Patatin 439 658 7.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218954
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the patatin-like phospholipase domain containing protein family. Members of this family are phospholipases which catalyze the cleavage of fatty acids from membrane phospholipids. The product of this gene is a calcium-independent phospholipase. Mutations in this gene have been associated with mitochondrial myopathy with lactic acidosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit some female-specific embryonic lethality, reduced body weight and temperature, cold intolerance, decreased exercise tolerance and decreased mitochondria function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,254,216 E95G probably damaging Het
Abca4 C T 3: 122,138,447 T250I possibly damaging Het
Ahi1 G A 10: 20,969,121 R375H probably benign Het
Aimp1 T C 3: 132,672,083 K174E probably benign Het
Aire A G 10: 78,042,967 L82P probably damaging Het
Akap13 T A 7: 75,609,908 V760D possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Carf C T 1: 60,147,963 S540F probably damaging Het
Ccdc171 T A 4: 83,554,850 M172K probably benign Het
Chpt1 A T 10: 88,482,283 V199E possibly damaging Het
Cldn16 G A 16: 26,474,268 D65N possibly damaging Het
Cnga3 G A 1: 37,232,237 probably benign Het
Col14a1 A G 15: 55,380,850 T440A unknown Het
Creb3l3 A G 10: 81,085,718 I331T probably benign Het
Cul9 T C 17: 46,521,453 T1410A probably benign Het
Dnm1 T A 2: 32,333,063 probably null Het
Fhl5 A T 4: 25,214,716 Y20* probably null Het
Fignl1 T C 11: 11,802,557 D166G probably benign Het
Ghr T C 15: 3,325,965 I279V probably benign Het
Gm1979 T G 5: 26,000,300 S180R probably damaging Het
Hydin T C 8: 110,462,660 V1232A possibly damaging Het
Ifnar1 A G 16: 91,501,620 probably null Het
Inpp5d A G 1: 87,620,397 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnh2 T A 5: 24,321,793 S1002C probably damaging Het
Krt83 T A 15: 101,487,534 E319V probably damaging Het
Lbp A G 2: 158,317,549 I201V probably benign Het
Man1a2 G A 3: 100,684,932 probably benign Het
Myh8 A G 11: 67,297,500 T996A possibly damaging Het
Nat10 A G 2: 103,743,316 L319P probably damaging Het
Nelfa A G 5: 33,899,276 probably null Het
Olfr1447 A C 19: 12,901,439 Y114D probably damaging Het
Pcdha11 T A 18: 37,005,817 N166K probably damaging Het
Pcdha6 C A 18: 36,969,216 N487K probably damaging Het
Pcsk2 A G 2: 143,573,540 D91G possibly damaging Het
Pigp A G 16: 94,370,206 F22L probably benign Het
Ppargc1b T C 18: 61,315,909 K114R probably damaging Het
Ppfia2 A G 10: 106,857,569 D645G probably damaging Het
Rnf213 G A 11: 119,442,028 V2688I probably benign Het
Rnf43 A G 11: 87,732,125 H557R probably damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
Rrp9 G A 9: 106,483,022 D210N probably damaging Het
Scin G T 12: 40,079,808 Q329K possibly damaging Het
Scn7a T A 2: 66,703,900 H477L probably benign Het
Slc26a8 A T 17: 28,669,940 M195K probably benign Het
Spata13 A G 14: 60,756,428 K1110E probably damaging Het
Spata24 T A 18: 35,660,450 E103V probably damaging Het
Srek1 T C 13: 103,774,386 N25S probably damaging Het
Strada T C 11: 106,173,314 Y59C probably damaging Het
Tnrc6c T C 11: 117,736,005 W1143R probably damaging Het
Trip12 A T 1: 84,760,838 D765E probably benign Het
Ttbk2 G A 2: 120,750,317 R444C probably damaging Het
Ush2a T A 1: 188,912,106 I4555N possibly damaging Het
Vcan C T 13: 89,689,926 E2500K probably benign Het
Vps16 A G 2: 130,438,653 Y200C possibly damaging Het
Wdfy4 T A 14: 32,971,711 H2719L probably damaging Het
Zfhx2 T C 14: 55,074,196 D347G possibly damaging Het
Zfp653 G A 9: 22,058,262 T236I probably damaging Het
Zscan4-ps1 A T 7: 11,065,986 H325Q probably benign Het
Other mutations in Pnpla8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Pnpla8 APN 12 44283069 missense probably benign 0.00
IGL01477:Pnpla8 APN 12 44283658 missense probably damaging 0.98
IGL01963:Pnpla8 APN 12 44296033 missense possibly damaging 0.88
IGL02877:Pnpla8 APN 12 44283465 missense probably benign 0.13
IGL03085:Pnpla8 APN 12 44311522 missense probably benign 0.01
IGL03335:Pnpla8 APN 12 44283164 missense probably benign 0.03
IGL03396:Pnpla8 APN 12 44283526 missense probably benign 0.01
Bantamweight UTSW 12 44304947 missense possibly damaging 0.65
featherweight UTSW 12 44295970 nonsense probably null
freerange UTSW 12 44283247 missense possibly damaging 0.94
R0063:Pnpla8 UTSW 12 44282832 missense probably damaging 1.00
R0063:Pnpla8 UTSW 12 44282832 missense probably damaging 1.00
R0172:Pnpla8 UTSW 12 44311328 missense probably damaging 1.00
R0524:Pnpla8 UTSW 12 44283618 nonsense probably null
R0608:Pnpla8 UTSW 12 44283463 missense probably benign 0.36
R0811:Pnpla8 UTSW 12 44283405 missense probably benign 0.03
R0812:Pnpla8 UTSW 12 44283405 missense probably benign 0.03
R1120:Pnpla8 UTSW 12 44304947 missense possibly damaging 0.65
R2127:Pnpla8 UTSW 12 44308057 missense probably benign 0.37
R2392:Pnpla8 UTSW 12 44311504 missense probably damaging 1.00
R4411:Pnpla8 UTSW 12 44283442 missense probably benign 0.00
R4714:Pnpla8 UTSW 12 44295913 missense probably damaging 1.00
R5446:Pnpla8 UTSW 12 44290585 missense possibly damaging 0.94
R5585:Pnpla8 UTSW 12 44283064 missense probably benign 0.06
R5752:Pnpla8 UTSW 12 44282887 missense probably benign 0.04
R5914:Pnpla8 UTSW 12 44295970 nonsense probably null
R6125:Pnpla8 UTSW 12 44307989 missense possibly damaging 0.65
R6224:Pnpla8 UTSW 12 44283028 missense possibly damaging 0.82
R6905:Pnpla8 UTSW 12 44283553 missense probably damaging 1.00
R6933:Pnpla8 UTSW 12 44283427 missense probably benign 0.00
R6983:Pnpla8 UTSW 12 44283247 missense possibly damaging 0.94
R7334:Pnpla8 UTSW 12 44311503 missense probably damaging 1.00
R7529:Pnpla8 UTSW 12 44283180 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATGCAAGAAGTCTTTGTGGGAAAC -3'
(R):5'- ACTCGACGGCTTGCTTAAC -3'

Sequencing Primer
(F):5'- TCTTTGTGGGAAACAGAGAAGC -3'
(R):5'- CTTTTCTTAATATTCGAGAACTTGGC -3'
Posted On2017-10-10