Incidental Mutation 'R6135:Srek1'
ID488309
Institutional Source Beutler Lab
Gene Symbol Srek1
Ensembl Gene ENSMUSG00000032621
Gene Namesplicing regulatory glutamine/lysine-rich protein 1
SynonymsSRrp508, Sfrs12, SRrp86
MMRRC Submission 044282-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R6135 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location103739348-103774608 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103774386 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 25 (N25S)
Ref Sequence ENSEMBL: ENSMUSP00000074196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074616] [ENSMUST00000211322]
Predicted Effect probably damaging
Transcript: ENSMUST00000074616
AA Change: N25S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074196
Gene: ENSMUSG00000032621
AA Change: N25S

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
RRM 70 141 1.22e-18 SMART
coiled coil region 259 298 N/A INTRINSIC
low complexity region 356 395 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 414 427 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211139
Predicted Effect probably benign
Transcript: ENSMUST00000211322
Meta Mutation Damage Score 0.3856 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of serine/arginine-rich (SR) splicing proteins containing RNA recognition motif (RRM) domains. The encoded protein interacts with other SR proteins to modulate splice site selection. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,254,216 E95G probably damaging Het
Abca4 C T 3: 122,138,447 T250I possibly damaging Het
Ahi1 G A 10: 20,969,121 R375H probably benign Het
Aimp1 T C 3: 132,672,083 K174E probably benign Het
Aire A G 10: 78,042,967 L82P probably damaging Het
Akap13 T A 7: 75,609,908 V760D possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Carf C T 1: 60,147,963 S540F probably damaging Het
Ccdc171 T A 4: 83,554,850 M172K probably benign Het
Chpt1 A T 10: 88,482,283 V199E possibly damaging Het
Cldn16 G A 16: 26,474,268 D65N possibly damaging Het
Cnga3 G A 1: 37,232,237 probably benign Het
Col14a1 A G 15: 55,380,850 T440A unknown Het
Creb3l3 A G 10: 81,085,718 I331T probably benign Het
Cul9 T C 17: 46,521,453 T1410A probably benign Het
Dnm1 T A 2: 32,333,063 probably null Het
Fhl5 A T 4: 25,214,716 Y20* probably null Het
Fignl1 T C 11: 11,802,557 D166G probably benign Het
Ghr T C 15: 3,325,965 I279V probably benign Het
Gm1979 T G 5: 26,000,300 S180R probably damaging Het
Hydin T C 8: 110,462,660 V1232A possibly damaging Het
Ifnar1 A G 16: 91,501,620 probably null Het
Inpp5d A G 1: 87,620,397 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnh2 T A 5: 24,321,793 S1002C probably damaging Het
Krt83 T A 15: 101,487,534 E319V probably damaging Het
Lbp A G 2: 158,317,549 I201V probably benign Het
Man1a2 G A 3: 100,684,932 probably benign Het
Myh8 A G 11: 67,297,500 T996A possibly damaging Het
Nat10 A G 2: 103,743,316 L319P probably damaging Het
Nelfa A G 5: 33,899,276 probably null Het
Olfr1447 A C 19: 12,901,439 Y114D probably damaging Het
Pcdha11 T A 18: 37,005,817 N166K probably damaging Het
Pcdha6 C A 18: 36,969,216 N487K probably damaging Het
Pcsk2 A G 2: 143,573,540 D91G possibly damaging Het
Pigp A G 16: 94,370,206 F22L probably benign Het
Pnpla8 A C 12: 44,282,887 N74T probably benign Het
Ppargc1b T C 18: 61,315,909 K114R probably damaging Het
Ppfia2 A G 10: 106,857,569 D645G probably damaging Het
Rnf213 G A 11: 119,442,028 V2688I probably benign Het
Rnf43 A G 11: 87,732,125 H557R probably damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
Rrp9 G A 9: 106,483,022 D210N probably damaging Het
Scin G T 12: 40,079,808 Q329K possibly damaging Het
Scn7a T A 2: 66,703,900 H477L probably benign Het
Slc26a8 A T 17: 28,669,940 M195K probably benign Het
Spata13 A G 14: 60,756,428 K1110E probably damaging Het
Spata24 T A 18: 35,660,450 E103V probably damaging Het
Strada T C 11: 106,173,314 Y59C probably damaging Het
Tnrc6c T C 11: 117,736,005 W1143R probably damaging Het
Trip12 A T 1: 84,760,838 D765E probably benign Het
Ttbk2 G A 2: 120,750,317 R444C probably damaging Het
Ush2a T A 1: 188,912,106 I4555N possibly damaging Het
Vcan C T 13: 89,689,926 E2500K probably benign Het
Vps16 A G 2: 130,438,653 Y200C possibly damaging Het
Wdfy4 T A 14: 32,971,711 H2719L probably damaging Het
Zfhx2 T C 14: 55,074,196 D347G possibly damaging Het
Zfp653 G A 9: 22,058,262 T236I probably damaging Het
Zscan4-ps1 A T 7: 11,065,986 H325Q probably benign Het
Other mutations in Srek1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01756:Srek1 APN 13 103760582 missense probably damaging 1.00
IGL01834:Srek1 APN 13 103748785 unclassified probably benign
IGL03029:Srek1 APN 13 103763960 utr 5 prime probably benign
IGL03198:Srek1 APN 13 103744935 splice site probably null
IGL03284:Srek1 APN 13 103760537 missense probably damaging 0.96
inscruitable UTSW 13 103774386 missense probably damaging 1.00
PIT4453001:Srek1 UTSW 13 103744783 critical splice donor site probably null
R0080:Srek1 UTSW 13 103743686 missense unknown
R0082:Srek1 UTSW 13 103743686 missense unknown
R0106:Srek1 UTSW 13 103743623 missense unknown
R0106:Srek1 UTSW 13 103743623 missense unknown
R0506:Srek1 UTSW 13 103760590 missense probably damaging 0.99
R0569:Srek1 UTSW 13 103748862 unclassified probably benign
R0969:Srek1 UTSW 13 103752503 unclassified probably benign
R1617:Srek1 UTSW 13 103743604 missense unknown
R2098:Srek1 UTSW 13 103744855 missense unknown
R2423:Srek1 UTSW 13 103753028 nonsense probably null
R3950:Srek1 UTSW 13 103744895 missense unknown
R4347:Srek1 UTSW 13 103748759 missense probably null
R4676:Srek1 UTSW 13 103758187 splice site probably benign
R4915:Srek1 UTSW 13 103752563 unclassified probably benign
R4915:Srek1 UTSW 13 103752686 utr 3 prime probably benign
R5119:Srek1 UTSW 13 103752556 unclassified probably benign
R5677:Srek1 UTSW 13 103759244 missense probably damaging 0.98
R6458:Srek1 UTSW 13 103743568 missense probably benign 0.01
R7406:Srek1 UTSW 13 103769382 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCATCAAACATGGCCGCCTAG -3'
(R):5'- AGTGACGCCTAGCAACAGTC -3'

Sequencing Primer
(F):5'- ACATGGCCGCCTAGGGAAG -3'
(R):5'- CGCGGAGGATTAGCTCTC -3'
Posted On2017-10-10