Incidental Mutation 'R6135:Olfr1447'
ID488326
Institutional Source Beutler Lab
Gene Symbol Olfr1447
Ensembl Gene ENSMUSG00000060303
Gene Nameolfactory receptor 1447
SynonymsGA_x6K02T2RE5P-3231251-3230331, MOR202-3
MMRRC Submission 044282-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6135 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location12899434-12903743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 12901439 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 114 (Y114D)
Ref Sequence ENSEMBL: ENSMUSP00000149392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071484] [ENSMUST00000208343] [ENSMUST00000216989]
Predicted Effect probably damaging
Transcript: ENSMUST00000071484
AA Change: Y114D

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000071419
Gene: ENSMUSG00000060303
AA Change: Y114D

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 5.3e-50 PFAM
Pfam:7TM_GPCR_Srsx 36 306 2.1e-7 PFAM
Pfam:7tm_1 42 291 7.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208343
Predicted Effect probably damaging
Transcript: ENSMUST00000216989
AA Change: Y114D

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218013
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220222
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,254,216 E95G probably damaging Het
Abca4 C T 3: 122,138,447 T250I possibly damaging Het
Ahi1 G A 10: 20,969,121 R375H probably benign Het
Aimp1 T C 3: 132,672,083 K174E probably benign Het
Aire A G 10: 78,042,967 L82P probably damaging Het
Akap13 T A 7: 75,609,908 V760D possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Carf C T 1: 60,147,963 S540F probably damaging Het
Ccdc171 T A 4: 83,554,850 M172K probably benign Het
Chpt1 A T 10: 88,482,283 V199E possibly damaging Het
Cldn16 G A 16: 26,474,268 D65N possibly damaging Het
Cnga3 G A 1: 37,232,237 probably benign Het
Col14a1 A G 15: 55,380,850 T440A unknown Het
Creb3l3 A G 10: 81,085,718 I331T probably benign Het
Cul9 T C 17: 46,521,453 T1410A probably benign Het
Dnm1 T A 2: 32,333,063 probably null Het
Fhl5 A T 4: 25,214,716 Y20* probably null Het
Fignl1 T C 11: 11,802,557 D166G probably benign Het
Ghr T C 15: 3,325,965 I279V probably benign Het
Gm1979 T G 5: 26,000,300 S180R probably damaging Het
Hydin T C 8: 110,462,660 V1232A possibly damaging Het
Ifnar1 A G 16: 91,501,620 probably null Het
Inpp5d A G 1: 87,620,397 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnh2 T A 5: 24,321,793 S1002C probably damaging Het
Krt83 T A 15: 101,487,534 E319V probably damaging Het
Lbp A G 2: 158,317,549 I201V probably benign Het
Man1a2 G A 3: 100,684,932 probably benign Het
Myh8 A G 11: 67,297,500 T996A possibly damaging Het
Nat10 A G 2: 103,743,316 L319P probably damaging Het
Nelfa A G 5: 33,899,276 probably null Het
Pcdha11 T A 18: 37,005,817 N166K probably damaging Het
Pcdha6 C A 18: 36,969,216 N487K probably damaging Het
Pcsk2 A G 2: 143,573,540 D91G possibly damaging Het
Pigp A G 16: 94,370,206 F22L probably benign Het
Pnpla8 A C 12: 44,282,887 N74T probably benign Het
Ppargc1b T C 18: 61,315,909 K114R probably damaging Het
Ppfia2 A G 10: 106,857,569 D645G probably damaging Het
Rnf213 G A 11: 119,442,028 V2688I probably benign Het
Rnf43 A G 11: 87,732,125 H557R probably damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
Rrp9 G A 9: 106,483,022 D210N probably damaging Het
Scin G T 12: 40,079,808 Q329K possibly damaging Het
Scn7a T A 2: 66,703,900 H477L probably benign Het
Slc26a8 A T 17: 28,669,940 M195K probably benign Het
Spata13 A G 14: 60,756,428 K1110E probably damaging Het
Spata24 T A 18: 35,660,450 E103V probably damaging Het
Srek1 T C 13: 103,774,386 N25S probably damaging Het
Strada T C 11: 106,173,314 Y59C probably damaging Het
Tnrc6c T C 11: 117,736,005 W1143R probably damaging Het
Trip12 A T 1: 84,760,838 D765E probably benign Het
Ttbk2 G A 2: 120,750,317 R444C probably damaging Het
Ush2a T A 1: 188,912,106 I4555N possibly damaging Het
Vcan C T 13: 89,689,926 E2500K probably benign Het
Vps16 A G 2: 130,438,653 Y200C possibly damaging Het
Wdfy4 T A 14: 32,971,711 H2719L probably damaging Het
Zfhx2 T C 14: 55,074,196 D347G possibly damaging Het
Zfp653 G A 9: 22,058,262 T236I probably damaging Het
Zscan4-ps1 A T 7: 11,065,986 H325Q probably benign Het
Other mutations in Olfr1447
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Olfr1447 APN 19 12901355 missense probably benign 0.40
IGL01704:Olfr1447 APN 19 12901739 missense probably benign 0.01
IGL01767:Olfr1447 APN 19 12901748 missense probably benign 0.12
IGL01969:Olfr1447 APN 19 12901052 missense possibly damaging 0.69
IGL02435:Olfr1447 APN 19 12901027 missense probably damaging 1.00
IGL02666:Olfr1447 APN 19 12900857 missense probably benign
IGL03034:Olfr1447 APN 19 12901757 missense possibly damaging 0.94
IGL03221:Olfr1447 APN 19 12901541 missense probably damaging 1.00
R0315:Olfr1447 UTSW 19 12901234 missense possibly damaging 0.66
R0550:Olfr1447 UTSW 19 12901800 splice site probably null
R0729:Olfr1447 UTSW 19 12900895 missense probably damaging 0.97
R1381:Olfr1447 UTSW 19 12900956 missense probably benign 0.00
R1669:Olfr1447 UTSW 19 12901288 missense possibly damaging 0.79
R1775:Olfr1447 UTSW 19 12901235 missense probably benign 0.02
R1918:Olfr1447 UTSW 19 12900851 makesense probably null
R2377:Olfr1447 UTSW 19 12900853 missense possibly damaging 0.45
R2406:Olfr1447 UTSW 19 12901627 missense probably benign 0.11
R2471:Olfr1447 UTSW 19 12901315 missense probably benign 0.00
R2484:Olfr1447 UTSW 19 12901641 missense probably benign 0.06
R2656:Olfr1447 UTSW 19 12901666 missense probably benign 0.37
R3888:Olfr1447 UTSW 19 12901133 missense probably benign 0.00
R4250:Olfr1447 UTSW 19 12901004 missense probably benign 0.09
R4545:Olfr1447 UTSW 19 12901268 nonsense probably null
R4895:Olfr1447 UTSW 19 12900887 missense probably damaging 1.00
R4956:Olfr1447 UTSW 19 12901599 missense probably damaging 0.99
R4991:Olfr1447 UTSW 19 12901451 missense probably damaging 0.98
R5044:Olfr1447 UTSW 19 12901001 missense probably damaging 1.00
R5165:Olfr1447 UTSW 19 12901200 missense probably benign 0.00
R6025:Olfr1447 UTSW 19 12901670 missense probably benign 0.10
R6459:Olfr1447 UTSW 19 12901005 missense possibly damaging 0.94
R6733:Olfr1447 UTSW 19 12901241 missense probably damaging 1.00
R6789:Olfr1447 UTSW 19 12901289 missense probably benign 0.21
R6923:Olfr1447 UTSW 19 12901312 missense probably benign 0.04
R7310:Olfr1447 UTSW 19 12901273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGATGGATCACATTGGACTTGC -3'
(R):5'- ACCTAGGGATGATCCTGCTG -3'

Sequencing Primer
(F):5'- TCACATTGGACTTGCAGAAGG -3'
(R):5'- ATGATCCTGCTGATTGTCCTGGAC -3'
Posted On2017-10-10