Incidental Mutation 'R6136:Setx'
ID488331
Institutional Source Beutler Lab
Gene Symbol Setx
Ensembl Gene ENSMUSG00000043535
Gene Namesenataxin
SynonymsA930037J23Rik, Als4
MMRRC Submission 044283-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6136 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location29124181-29182471 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29148027 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1508 (D1508G)
Ref Sequence ENSEMBL: ENSMUSP00000051492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061578]
Predicted Effect probably benign
Transcript: ENSMUST00000061578
AA Change: D1508G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000051492
Gene: ENSMUSG00000043535
AA Change: D1508G

DomainStartEndE-ValueType
low complexity region 864 876 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
low complexity region 1058 1079 N/A INTRINSIC
low complexity region 1575 1594 N/A INTRINSIC
Pfam:AAA_11 1909 2194 1.9e-68 PFAM
Pfam:AAA_19 1924 2015 2.9e-11 PFAM
Pfam:AAA_12 2201 2402 1.1e-54 PFAM
low complexity region 2499 2516 N/A INTRINSIC
low complexity region 2576 2587 N/A INTRINSIC
Meta Mutation Damage Score 0.0629 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein named for its homology to the Sen1p protein of fungi which has RNA helicase activity encoded by a domain at the C-terminal end of the protein. The protein encoded by this gene contains a DNA/RNA helicase domain at its C-terminal end which suggests that it may be involved in both DNA and RNA processing. Mutations in this gene have been associated with ataxia-ocular apraxia-2 (AOA2) and an autosomal dominant form of juvenile amyotrophic lateral sclerosis (ALS4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility due to arrested male meiosis and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,853 S729P probably damaging Het
3100002H09Rik C A 4: 124,610,388 G124C unknown Het
3425401B19Rik A T 14: 32,662,282 D575E possibly damaging Het
Abca15 A T 7: 120,340,049 H222L possibly damaging Het
Arhgef18 T C 8: 3,454,507 V1013A probably benign Het
Arsj T C 3: 126,364,775 M1T probably null Het
Atp10a A C 7: 58,828,340 Q1377P probably benign Het
Atrip T A 9: 109,071,736 E178D probably damaging Het
Chadl T C 15: 81,693,554 N625D probably benign Het
Chrng G A 1: 87,209,801 V320I probably benign Het
Cox11 T C 11: 90,644,395 L84P probably damaging Het
Dchs1 T G 7: 105,760,925 T1747P probably benign Het
Dnah12 A G 14: 26,875,270 K3529E probably damaging Het
Ecd T C 14: 20,320,791 N620S probably damaging Het
Fbn1 T A 2: 125,403,132 K278N possibly damaging Het
Fcho2 T C 13: 98,789,767 K103E probably damaging Het
Fzd7 T G 1: 59,483,260 F101V probably damaging Het
Galnt13 G T 2: 54,516,479 probably benign Het
Gif G A 19: 11,750,285 A158T probably damaging Het
Gm32647 C T 7: 94,475,732 Het
Gm5624 A T 14: 44,559,876 D152E probably benign Het
Heatr6 T A 11: 83,772,503 V664E possibly damaging Het
Hpgd A G 8: 56,294,952 D36G probably damaging Het
Ifnlr1 A G 4: 135,703,797 T199A possibly damaging Het
Kalrn T G 16: 34,357,111 D228A probably damaging Het
Miox T C 15: 89,335,321 M47T probably damaging Het
Nampt A T 12: 32,830,302 I65F probably benign Het
Ncf1 T C 5: 134,226,633 K135E probably damaging Het
Nop53 G A 7: 15,938,389 Q452* probably null Het
Olfr1037 A G 2: 86,084,901 L292S probably damaging Het
Pik3cg A G 12: 32,204,359 V543A probably benign Het
Ralgds T C 2: 28,550,565 probably null Het
Rap1a A G 3: 105,750,282 V7A probably damaging Het
Rasal1 T C 5: 120,675,478 V639A possibly damaging Het
Rassf8 A G 6: 145,815,656 N236S probably benign Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Sbno1 T C 5: 124,378,491 D1272G probably benign Het
Slc1a1 T A 19: 28,905,410 L358Q probably damaging Het
Slc7a12 C A 3: 14,499,126 L20I probably benign Het
Spats2l C T 1: 57,902,143 T187M probably damaging Het
Specc1l A G 10: 75,246,660 D647G probably benign Het
Steap4 G A 5: 7,978,562 R380Q probably damaging Het
Syne2 A G 12: 75,905,325 S456G probably benign Het
Tfcp2 G T 15: 100,512,313 T391N probably damaging Het
Tns2 T A 15: 102,107,030 D122E probably damaging Het
Tshr A G 12: 91,538,234 M649V probably benign Het
Ubr3 A G 2: 69,993,763 T1440A probably benign Het
Urb2 A G 8: 124,030,092 D846G probably benign Het
Vmn1r202 T C 13: 22,501,462 T262A possibly damaging Het
Vmn2r61 G T 7: 42,267,031 W356L probably damaging Het
Wdr11 T A 7: 129,618,703 M605K possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Setx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Setx APN 2 29148445 missense possibly damaging 0.50
IGL00806:Setx APN 2 29127026 missense probably damaging 1.00
IGL01346:Setx APN 2 29144809 missense probably damaging 1.00
IGL01623:Setx APN 2 29163009 missense possibly damaging 0.70
IGL02351:Setx APN 2 29146964 missense probably benign 0.45
IGL02358:Setx APN 2 29146964 missense probably benign 0.45
IGL02378:Setx APN 2 29173726 splice site probably benign
IGL02388:Setx APN 2 29173653 missense probably damaging 1.00
IGL02408:Setx APN 2 29133930 missense probably damaging 1.00
IGL02425:Setx APN 2 29148408 missense probably benign 0.00
IGL03023:Setx APN 2 29145902 missense probably benign 0.02
IGL03351:Setx APN 2 29161799 missense probably benign 0.25
Addison UTSW 2 29158905 missense probably damaging 1.00
dallas UTSW 2 29154061 frame shift probably null
Denton UTSW 2 29145060 missense possibly damaging 0.81
doggie UTSW 2 29164550 missense probably damaging 1.00
Irving UTSW 2 29139221 missense probably damaging 0.99
IGL03014:Setx UTSW 2 29139411 missense probably damaging 1.00
PIT4403001:Setx UTSW 2 29133955 missense probably damaging 1.00
R0027:Setx UTSW 2 29139221 missense probably damaging 0.99
R0031:Setx UTSW 2 29176929 missense probably benign 0.02
R0070:Setx UTSW 2 29161525 missense probably benign 0.00
R0070:Setx UTSW 2 29161525 missense probably benign 0.00
R0092:Setx UTSW 2 29146293 missense probably benign 0.00
R0193:Setx UTSW 2 29179673 missense probably benign 0.21
R0281:Setx UTSW 2 29179643 missense probably benign 0.00
R0401:Setx UTSW 2 29166289 nonsense probably null
R0413:Setx UTSW 2 29139278 missense probably damaging 1.00
R0517:Setx UTSW 2 29157133 missense probably benign 0.00
R0536:Setx UTSW 2 29158248 missense possibly damaging 0.46
R0617:Setx UTSW 2 29146807 missense possibly damaging 0.86
R1183:Setx UTSW 2 29180092 missense probably benign
R1331:Setx UTSW 2 29179686 missense probably benign
R1465:Setx UTSW 2 29140389 critical splice donor site probably null
R1465:Setx UTSW 2 29140389 critical splice donor site probably null
R1467:Setx UTSW 2 29158905 missense probably damaging 1.00
R1467:Setx UTSW 2 29158905 missense probably damaging 1.00
R1482:Setx UTSW 2 29162992 missense probably damaging 0.99
R1599:Setx UTSW 2 29140373 missense probably benign 0.04
R1663:Setx UTSW 2 29126905 missense probably damaging 1.00
R1909:Setx UTSW 2 29163009 missense possibly damaging 0.70
R2117:Setx UTSW 2 29130301 missense probably benign 0.01
R2207:Setx UTSW 2 29154061 frame shift probably null
R2221:Setx UTSW 2 29154061 frame shift probably null
R2223:Setx UTSW 2 29148537 missense possibly damaging 0.89
R2223:Setx UTSW 2 29154061 frame shift probably null
R2273:Setx UTSW 2 29154061 frame shift probably null
R2274:Setx UTSW 2 29154061 frame shift probably null
R2275:Setx UTSW 2 29154061 frame shift probably null
R2309:Setx UTSW 2 29158904 missense probably damaging 1.00
R2328:Setx UTSW 2 29154060 frame shift probably null
R2328:Setx UTSW 2 29154061 frame shift probably null
R2329:Setx UTSW 2 29154061 frame shift probably null
R2331:Setx UTSW 2 29154061 frame shift probably null
R2332:Setx UTSW 2 29154061 frame shift probably null
R2429:Setx UTSW 2 29179898 missense probably benign 0.00
R2438:Setx UTSW 2 29154061 frame shift probably null
R2439:Setx UTSW 2 29154061 frame shift probably null
R2496:Setx UTSW 2 29144801 missense probably benign 0.11
R2858:Setx UTSW 2 29154061 frame shift probably null
R2859:Setx UTSW 2 29154061 frame shift probably null
R2884:Setx UTSW 2 29148625 missense probably damaging 0.98
R2885:Setx UTSW 2 29148625 missense probably damaging 0.98
R2886:Setx UTSW 2 29148625 missense probably damaging 0.98
R2915:Setx UTSW 2 29172324 missense probably damaging 0.99
R2921:Setx UTSW 2 29154060 small deletion probably benign
R2921:Setx UTSW 2 29154061 frame shift probably null
R2923:Setx UTSW 2 29154061 frame shift probably null
R3426:Setx UTSW 2 29154061 frame shift probably null
R3609:Setx UTSW 2 29154061 frame shift probably null
R3610:Setx UTSW 2 29154061 frame shift probably null
R3731:Setx UTSW 2 29154061 frame shift probably null
R3813:Setx UTSW 2 29154061 frame shift probably null
R3835:Setx UTSW 2 29145060 missense possibly damaging 0.81
R3871:Setx UTSW 2 29145741 missense probably damaging 0.98
R4013:Setx UTSW 2 29154061 frame shift probably null
R4014:Setx UTSW 2 29154061 frame shift probably null
R4015:Setx UTSW 2 29154061 frame shift probably null
R4017:Setx UTSW 2 29154061 frame shift probably null
R4246:Setx UTSW 2 29154061 frame shift probably null
R4248:Setx UTSW 2 29154061 frame shift probably null
R4297:Setx UTSW 2 29154061 frame shift probably null
R4298:Setx UTSW 2 29154061 frame shift probably null
R4539:Setx UTSW 2 29179748 missense probably benign 0.14
R4590:Setx UTSW 2 29144809 missense probably damaging 1.00
R4632:Setx UTSW 2 29148615 missense probably benign 0.23
R4782:Setx UTSW 2 29144046 missense probably damaging 0.99
R4801:Setx UTSW 2 29146373 missense probably benign 0.14
R4802:Setx UTSW 2 29146373 missense probably benign 0.14
R4975:Setx UTSW 2 29164550 missense probably damaging 1.00
R5040:Setx UTSW 2 29139338 missense probably damaging 1.00
R5133:Setx UTSW 2 29180081 missense probably benign 0.02
R5208:Setx UTSW 2 29166367 missense possibly damaging 0.63
R5237:Setx UTSW 2 29146983 missense probably benign 0.00
R5248:Setx UTSW 2 29148418 missense probably benign 0.26
R5288:Setx UTSW 2 29134033 critical splice donor site probably null
R5385:Setx UTSW 2 29134033 critical splice donor site probably null
R5387:Setx UTSW 2 29147594 missense probably benign 0.00
R5407:Setx UTSW 2 29145474 missense probably benign 0.00
R5685:Setx UTSW 2 29171280 missense probably damaging 1.00
R6110:Setx UTSW 2 29140290 missense probably damaging 1.00
R6310:Setx UTSW 2 29176935 missense possibly damaging 0.57
R6328:Setx UTSW 2 29174462 intron probably benign
R6358:Setx UTSW 2 29171348 missense possibly damaging 0.79
R6384:Setx UTSW 2 29173558 missense probably damaging 1.00
R6400:Setx UTSW 2 29130274 missense probably damaging 0.97
R6572:Setx UTSW 2 29173694 missense possibly damaging 0.63
R6662:Setx UTSW 2 29158114 missense probably damaging 0.97
R6898:Setx UTSW 2 29148108 missense probably benign 0.00
R7188:Setx UTSW 2 29148172 missense probably benign 0.02
R7332:Setx UTSW 2 29146626 missense probably benign 0.00
R7357:Setx UTSW 2 29130301 missense probably benign 0.01
R7556:Setx UTSW 2 29146493 missense possibly damaging 0.88
R7646:Setx UTSW 2 29177549 missense possibly damaging 0.94
X0066:Setx UTSW 2 29147879 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGTCACAGTTCAAGTTGGG -3'
(R):5'- GCGCTGCTTGAGCTAAATATC -3'

Sequencing Primer
(F):5'- CACAGTTCAAGTTGGGGAGGTG -3'
(R):5'- TAGTAGTAGGTCTCAAGGGCC -3'
Posted On2017-10-10