Mutagenetix > Incidental Mutations

Incidental Mutation 'R6136:Ubr3'

488333

Institutional Source

Beutler Lab

Gene Symbol

Ubr3

Ensembl Gene

ENSMUSG00000044308

Gene Name

ubiquitin protein ligase E3 component n-recognin 3

Synonyms

Zfp650, 4833421P10Rik, A130030D10Rik, 1110059H15Rik

MMRRC Submission

044283-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6136 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

69897246-70024013 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 69993763 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1440 (T1440A)

Ref Sequence

ENSEMBL: ENSMUSP00000060159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055758] [ENSMUST00000112251] [ENSMUST00000152610]

Predicted Effect

probably benign
Transcript: ENSMUST00000055758
AA Change: T1440A

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000060159
Gene: ENSMUSG00000044308
AA Change: T1440A

Domain	Start	End	E-Value	Type
low complexity region	13	40	N/A	INTRINSIC
low complexity region	67	88	N/A	INTRINSIC
Pfam:zf-UBR	118	188	1.6e-19	PFAM
low complexity region	339	354	N/A	INTRINSIC
low complexity region	570	580	N/A	INTRINSIC
low complexity region	1016	1027	N/A	INTRINSIC
low complexity region	1082	1101	N/A	INTRINSIC
coiled coil region	1167	1199	N/A	INTRINSIC
Blast:RING	1289	1363	8e-39	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000112251
AA Change: T1443A

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000107870
Gene: ENSMUSG00000044308
AA Change: T1443A

Domain	Start	End	E-Value	Type
low complexity region	13	40	N/A	INTRINSIC
low complexity region	67	88	N/A	INTRINSIC
Pfam:zf-UBR	119	187	1.7e-21	PFAM
low complexity region	338	353	N/A	INTRINSIC
low complexity region	569	579	N/A	INTRINSIC
low complexity region	1015	1026	N/A	INTRINSIC
low complexity region	1081	1100	N/A	INTRINSIC
coiled coil region	1166	1198	N/A	INTRINSIC
Blast:RING	1288	1362	8e-39	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126165

Predicted Effect

probably benign
Transcript: ENSMUST00000152610
AA Change: T134A

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000122027
Gene: ENSMUSG00000044308
AA Change: T134A

Domain	Start	End	E-Value	Type
Blast:RING	1	57	1e-34	BLAST
SCOP:d1jm7a_	20	84	4e-3	SMART

Meta Mutation Damage Score

0.0608

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

98% (52/53)

MGI Phenotype

PHENOTYPE: Homozygous null mice obtained on a coisogenic 129S1 background die early in embryogenesis while those on a mixed 129S1/B6 background are born at a slightly reduced frequency. On a congenic C57BL/6 background, homozygotes display neonatal lethality, impaired suckling and female behavioral anosmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	T	C	4: 42,972,853	S729P	probably damaging	Het
3100002H09Rik	C	A	4: 124,610,388	G124C	unknown	Het
3425401B19Rik	A	T	14: 32,662,282	D575E	possibly damaging	Het
Abca15	A	T	7: 120,340,049	H222L	possibly damaging	Het
Arhgef18	T	C	8: 3,454,507	V1013A	probably benign	Het
Arsj	T	C	3: 126,364,775	M1T	probably null	Het
Atp10a	A	C	7: 58,828,340	Q1377P	probably benign	Het
Atrip	T	A	9: 109,071,736	E178D	probably damaging	Het
Chadl	T	C	15: 81,693,554	N625D	probably benign	Het
Chrng	G	A	1: 87,209,801	V320I	probably benign	Het
Cox11	T	C	11: 90,644,395	L84P	probably damaging	Het
Dchs1	T	G	7: 105,760,925	T1747P	probably benign	Het
Dnah12	A	G	14: 26,875,270	K3529E	probably damaging	Het
Ecd	T	C	14: 20,320,791	N620S	probably damaging	Het
Fbn1	T	A	2: 125,403,132	K278N	possibly damaging	Het
Fcho2	T	C	13: 98,789,767	K103E	probably damaging	Het
Fzd7	T	G	1: 59,483,260	F101V	probably damaging	Het
Galnt13	G	T	2: 54,516,479		probably benign	Het
Gif	G	A	19: 11,750,285	A158T	probably damaging	Het
Gm32647	C	T	7: 94,475,732			Het
Gm5624	A	T	14: 44,559,876	D152E	probably benign	Het
Heatr6	T	A	11: 83,772,503	V664E	possibly damaging	Het
Hpgd	A	G	8: 56,294,952	D36G	probably damaging	Het
Ifnlr1	A	G	4: 135,703,797	T199A	possibly damaging	Het
Kalrn	T	G	16: 34,357,111	D228A	probably damaging	Het
Miox	T	C	15: 89,335,321	M47T	probably damaging	Het
Nampt	A	T	12: 32,830,302	I65F	probably benign	Het
Ncf1	T	C	5: 134,226,633	K135E	probably damaging	Het
Nop53	G	A	7: 15,938,389	Q452*	probably null	Het
Olfr1037	A	G	2: 86,084,901	L292S	probably damaging	Het
Pik3cg	A	G	12: 32,204,359	V543A	probably benign	Het
Ralgds	T	C	2: 28,550,565		probably null	Het
Rap1a	A	G	3: 105,750,282	V7A	probably damaging	Het
Rasal1	T	C	5: 120,675,478	V639A	possibly damaging	Het
Rassf8	A	G	6: 145,815,656	N236S	probably benign	Het
Rbm47	G	C	5: 66,026,283	R326G	probably damaging	Het
Sbno1	T	C	5: 124,378,491	D1272G	probably benign	Het
Setx	A	G	2: 29,148,027	D1508G	probably benign	Het
Slc1a1	T	A	19: 28,905,410	L358Q	probably damaging	Het
Slc7a12	C	A	3: 14,499,126	L20I	probably benign	Het
Spats2l	C	T	1: 57,902,143	T187M	probably damaging	Het
Specc1l	A	G	10: 75,246,660	D647G	probably benign	Het
Steap4	G	A	5: 7,978,562	R380Q	probably damaging	Het
Syne2	A	G	12: 75,905,325	S456G	probably benign	Het
Tfcp2	G	T	15: 100,512,313	T391N	probably damaging	Het
Tns2	T	A	15: 102,107,030	D122E	probably damaging	Het
Tshr	A	G	12: 91,538,234	M649V	probably benign	Het
Urb2	A	G	8: 124,030,092	D846G	probably benign	Het
Vmn1r202	T	C	13: 22,501,462	T262A	possibly damaging	Het
Vmn2r61	G	T	7: 42,267,031	W356L	probably damaging	Het
Wdr11	T	A	7: 129,618,703	M605K	possibly damaging	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het

Other mutations in Ubr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Ubr3	APN	2	69988810	missense	probably benign	0.40
IGL00985:Ubr3	APN	2	70003431	missense	probably damaging	1.00
IGL01061:Ubr3	APN	2	69983225	missense	probably benign	0.05
IGL01325:Ubr3	APN	2	69917097	missense	possibly damaging	0.71
IGL01398:Ubr3	APN	2	69959653	missense	probably damaging	1.00
IGL01484:Ubr3	APN	2	70021544	nonsense	probably null
IGL01599:Ubr3	APN	2	69938178	missense	probably damaging	1.00
IGL01616:Ubr3	APN	2	70020484	missense	probably benign	0.14
IGL01634:Ubr3	APN	2	69973572	missense	probably benign
IGL01684:Ubr3	APN	2	70016158	nonsense	probably null
IGL01810:Ubr3	APN	2	70003465	splice site	probably null
IGL01813:Ubr3	APN	2	69951570	missense	probably benign	0.34
IGL01994:Ubr3	APN	2	70021176	missense	probably damaging	1.00
IGL02188:Ubr3	APN	2	69959611	nonsense	probably null
IGL02318:Ubr3	APN	2	69979397	missense	probably damaging	1.00
IGL02379:Ubr3	APN	2	69948488	missense	possibly damaging	0.91
IGL02635:Ubr3	APN	2	70020483	missense	probably damaging	0.96
IGL02858:Ubr3	APN	2	69952859	missense	probably damaging	1.00
IGL03140:Ubr3	APN	2	69970189	missense	probably damaging	1.00
IGL03343:Ubr3	APN	2	69973146	splice site	probably benign
Hyrax	UTSW	2	69952868	missense	probably benign	0.32
manatee	UTSW	2	69979386	nonsense	probably null
sea_cow	UTSW	2	69959669	splice site	probably null
R0094:Ubr3	UTSW	2	69951362	missense	probably damaging	1.00
R0094:Ubr3	UTSW	2	69951362	missense	probably damaging	1.00
R0122:Ubr3	UTSW	2	69979412	missense	probably damaging	1.00
R0243:Ubr3	UTSW	2	69951405	missense	probably damaging	1.00
R0710:Ubr3	UTSW	2	69952837	missense	probably damaging	1.00
R0787:Ubr3	UTSW	2	69951421	splice site	probably benign
R1137:Ubr3	UTSW	2	69938315	splice site	probably benign
R1191:Ubr3	UTSW	2	70021181	nonsense	probably null
R1416:Ubr3	UTSW	2	69945071	missense	probably damaging	1.00
R1623:Ubr3	UTSW	2	69977723	nonsense	probably null
R1735:Ubr3	UTSW	2	70009129	missense	probably damaging	1.00
R1789:Ubr3	UTSW	2	70016367	missense	possibly damaging	0.87
R1793:Ubr3	UTSW	2	70000551	splice site	probably benign
R1932:Ubr3	UTSW	2	69953476	splice site	probably null
R2042:Ubr3	UTSW	2	69977774	nonsense	probably null
R2085:Ubr3	UTSW	2	69953764	missense	probably damaging	1.00
R2090:Ubr3	UTSW	2	69936017	missense	probably damaging	1.00
R2112:Ubr3	UTSW	2	69977792	missense	possibly damaging	0.73
R2173:Ubr3	UTSW	2	69897399	missense	probably benign
R2215:Ubr3	UTSW	2	69979317	critical splice acceptor site	probably null
R2273:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2274:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2275:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2292:Ubr3	UTSW	2	69897260	unclassified	probably benign
R2447:Ubr3	UTSW	2	70003380	missense	probably damaging	1.00
R2504:Ubr3	UTSW	2	69938198	missense	probably damaging	0.99
R2517:Ubr3	UTSW	2	69936018	missense	probably damaging	1.00
R2901:Ubr3	UTSW	2	70016192	missense	possibly damaging	0.89
R3109:Ubr3	UTSW	2	69988840	missense	probably damaging	1.00
R3737:Ubr3	UTSW	2	69971234	critical splice donor site	probably null
R3793:Ubr3	UTSW	2	69917181	missense	possibly damaging	0.95
R3821:Ubr3	UTSW	2	69993813	critical splice donor site	probably null
R3918:Ubr3	UTSW	2	70016130	critical splice acceptor site	probably null
R4157:Ubr3	UTSW	2	69959669	splice site	probably null
R4235:Ubr3	UTSW	2	70016385	nonsense	probably null
R4276:Ubr3	UTSW	2	69938387	nonsense	probably null
R4544:Ubr3	UTSW	2	69956093	missense	probably benign	0.18
R4678:Ubr3	UTSW	2	69935919	missense	probably damaging	1.00
R4707:Ubr3	UTSW	2	69938370	intron	probably benign
R4785:Ubr3	UTSW	2	69959603	missense	probably damaging	1.00
R4872:Ubr3	UTSW	2	69970183	missense	probably damaging	1.00
R4887:Ubr3	UTSW	2	70013131	missense	probably damaging	0.99
R4920:Ubr3	UTSW	2	69952868	missense	probably benign	0.32
R4989:Ubr3	UTSW	2	70020446	splice site	probably benign
R5104:Ubr3	UTSW	2	69938256	missense	probably damaging	0.98
R5134:Ubr3	UTSW	2	70020446	splice site	probably benign
R5137:Ubr3	UTSW	2	69973335	missense	probably damaging	1.00
R5174:Ubr3	UTSW	2	70009162	missense	probably damaging	1.00
R5195:Ubr3	UTSW	2	69956034	missense	probably benign	0.00
R5437:Ubr3	UTSW	2	69944390	missense	probably damaging	1.00
R5539:Ubr3	UTSW	2	70020533	missense	probably damaging	1.00
R5781:Ubr3	UTSW	2	70016244	splice site	probably null
R5809:Ubr3	UTSW	2	69965511	missense	possibly damaging	0.90
R5913:Ubr3	UTSW	2	70021215	missense	probably damaging	1.00
R5969:Ubr3	UTSW	2	69979386	nonsense	probably null
R6140:Ubr3	UTSW	2	69973329	missense	probably benign	0.09
R6185:Ubr3	UTSW	2	69938277	missense	probably damaging	0.98
R6220:Ubr3	UTSW	2	70020475	missense	probably damaging	1.00
R6258:Ubr3	UTSW	2	69982864	splice site	probably null
R6319:Ubr3	UTSW	2	69973414	missense	probably benign	0.00
R6322:Ubr3	UTSW	2	69956085	nonsense	probably null
R6470:Ubr3	UTSW	2	69965460	missense	probably benign	0.02
R6477:Ubr3	UTSW	2	69979429	nonsense	probably null
R6702:Ubr3	UTSW	2	69956049	missense	probably benign	0.23
R6709:Ubr3	UTSW	2	70013092	missense	probably damaging	1.00
R6803:Ubr3	UTSW	2	69936024	critical splice donor site	probably null
R6806:Ubr3	UTSW	2	69955964	splice site	probably benign
R6834:Ubr3	UTSW	2	70000481	missense	possibly damaging	0.63
R6841:Ubr3	UTSW	2	70020625	missense	probably damaging	1.00
R6847:Ubr3	UTSW	2	69983128	missense	probably damaging	1.00
R6889:Ubr3	UTSW	2	69944300	missense	possibly damaging	0.70
R7065:Ubr3	UTSW	2	69953705	missense	probably damaging	1.00
R7102:Ubr3	UTSW	2	69897822	missense	probably damaging	1.00
R7156:Ubr3	UTSW	2	70021623	missense	probably damaging	1.00
R7209:Ubr3	UTSW	2	70016134	missense	probably benign	0.01
R7273:Ubr3	UTSW	2	69979333	missense	probably damaging	0.97
R7314:Ubr3	UTSW	2	69991600	missense	probably damaging	1.00
R7422:Ubr3	UTSW	2	69953542	critical splice donor site	probably null
R7584:Ubr3	UTSW	2	69991503	missense	probably damaging	1.00
R7588:Ubr3	UTSW	2	69971169	missense	probably damaging	1.00
R7597:Ubr3	UTSW	2	69973468	missense	possibly damaging	0.69
R7697:Ubr3	UTSW	2	69897686	missense	probably damaging	1.00
R7737:Ubr3	UTSW	2	69991566	missense	probably benign	0.07
R7743:Ubr3	UTSW	2	69944449	missense	probably benign	0.28
R7946:Ubr3	UTSW	2	69951395	missense	possibly damaging	0.95
R7991:Ubr3	UTSW	2	69952856	missense	probably damaging	1.00
R8071:Ubr3	UTSW	2	69988876	missense	probably damaging	0.99
R8136:Ubr3	UTSW	2	70021179	missense	probably damaging	1.00
R8296:Ubr3	UTSW	2	69954362	missense	probably null	1.00
R8313:Ubr3	UTSW	2	69945134	missense	probably damaging	0.99
Z1088:Ubr3	UTSW	2	69922367	missense	probably benign	0.00
Z1177:Ubr3	UTSW	2	69897461	missense	probably benign	0.17
Z1177:Ubr3	UTSW	2	69897666	missense	probably damaging	1.00
Z1177:Ubr3	UTSW	2	69973206	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCATCCAGAACTTGAGTAAGATAG -3'
(R):5'- TTCCTGGGAGGCTGTAAAAC -3'

Sequencing Primer
(F):5'- CCAGAACTTGAGTAAGATAGATTCAG -3'
(R):5'- CTGGGAGGCTGTAAAACTAGATATAC -3'

Posted On

2017-10-10