Incidental Mutation 'R6136:Rap1a'
ID488337
Institutional Source Beutler Lab
Gene Symbol Rap1a
Ensembl Gene ENSMUSG00000068798
Gene NameRAS-related protein 1a
SynonymsRap1, Krev-1
MMRRC Submission 044283-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R6136 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location105727267-105801336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105750282 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 7 (V7A)
Ref Sequence ENSEMBL: ENSMUSP00000088174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090678] [ENSMUST00000197094] [ENSMUST00000198004] [ENSMUST00000199969]
Predicted Effect probably damaging
Transcript: ENSMUST00000090678
AA Change: V7A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088174
Gene: ENSMUSG00000068798
AA Change: V7A

DomainStartEndE-ValueType
RAS 1 168 2.68e-120 SMART
low complexity region 173 179 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000197094
AA Change: V7A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142419
Gene: ENSMUSG00000068798
AA Change: V7A

DomainStartEndE-ValueType
RAS 1 102 1.5e-45 SMART
low complexity region 107 113 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198004
AA Change: V7A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142733
Gene: ENSMUSG00000068798
AA Change: V7A

DomainStartEndE-ValueType
RAS 1 109 1.9e-55 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199969
AA Change: V7A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142634
Gene: ENSMUSG00000068798
AA Change: V7A

DomainStartEndE-ValueType
RAS 1 158 2.53e-107 SMART
Meta Mutation Damage Score 0.6445 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras family of small GTPases. The encoded protein undergoes a change in conformational state and activity, depending on whether it is bound to GTP or GDP. This protein is activated by several types of guanine nucleotide exchange factors (GEFs), and inactivated by two groups of GTPase-activating proteins (GAPs). The activation status of the encoded protein is therefore affected by the balance of intracellular levels of GEFs and GAPs. The encoded protein regulates signaling pathways that affect cell proliferation and adhesion, and may play a role in tumor malignancy. Pseudogenes of this gene have been defined on chromosomes 14 and 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired leukocyte migration and decreased angiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,853 S729P probably damaging Het
3100002H09Rik C A 4: 124,610,388 G124C unknown Het
3425401B19Rik A T 14: 32,662,282 D575E possibly damaging Het
Abca15 A T 7: 120,340,049 H222L possibly damaging Het
Arhgef18 T C 8: 3,454,507 V1013A probably benign Het
Arsj T C 3: 126,364,775 M1T probably null Het
Atp10a A C 7: 58,828,340 Q1377P probably benign Het
Atrip T A 9: 109,071,736 E178D probably damaging Het
Chadl T C 15: 81,693,554 N625D probably benign Het
Chrng G A 1: 87,209,801 V320I probably benign Het
Cox11 T C 11: 90,644,395 L84P probably damaging Het
Dchs1 T G 7: 105,760,925 T1747P probably benign Het
Dnah12 A G 14: 26,875,270 K3529E probably damaging Het
Ecd T C 14: 20,320,791 N620S probably damaging Het
Fbn1 T A 2: 125,403,132 K278N possibly damaging Het
Fcho2 T C 13: 98,789,767 K103E probably damaging Het
Fzd7 T G 1: 59,483,260 F101V probably damaging Het
Galnt13 G T 2: 54,516,479 probably benign Het
Gif G A 19: 11,750,285 A158T probably damaging Het
Gm32647 C T 7: 94,475,732 Het
Gm5624 A T 14: 44,559,876 D152E probably benign Het
Heatr6 T A 11: 83,772,503 V664E possibly damaging Het
Hpgd A G 8: 56,294,952 D36G probably damaging Het
Ifnlr1 A G 4: 135,703,797 T199A possibly damaging Het
Kalrn T G 16: 34,357,111 D228A probably damaging Het
Miox T C 15: 89,335,321 M47T probably damaging Het
Nampt A T 12: 32,830,302 I65F probably benign Het
Ncf1 T C 5: 134,226,633 K135E probably damaging Het
Nop53 G A 7: 15,938,389 Q452* probably null Het
Olfr1037 A G 2: 86,084,901 L292S probably damaging Het
Pik3cg A G 12: 32,204,359 V543A probably benign Het
Ralgds T C 2: 28,550,565 probably null Het
Rasal1 T C 5: 120,675,478 V639A possibly damaging Het
Rassf8 A G 6: 145,815,656 N236S probably benign Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Sbno1 T C 5: 124,378,491 D1272G probably benign Het
Setx A G 2: 29,148,027 D1508G probably benign Het
Slc1a1 T A 19: 28,905,410 L358Q probably damaging Het
Slc7a12 C A 3: 14,499,126 L20I probably benign Het
Spats2l C T 1: 57,902,143 T187M probably damaging Het
Specc1l A G 10: 75,246,660 D647G probably benign Het
Steap4 G A 5: 7,978,562 R380Q probably damaging Het
Syne2 A G 12: 75,905,325 S456G probably benign Het
Tfcp2 G T 15: 100,512,313 T391N probably damaging Het
Tns2 T A 15: 102,107,030 D122E probably damaging Het
Tshr A G 12: 91,538,234 M649V probably benign Het
Ubr3 A G 2: 69,993,763 T1440A probably benign Het
Urb2 A G 8: 124,030,092 D846G probably benign Het
Vmn1r202 T C 13: 22,501,462 T262A possibly damaging Het
Vmn2r61 G T 7: 42,267,031 W356L probably damaging Het
Wdr11 T A 7: 129,618,703 M605K possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Rap1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Rap1a APN 3 105732035 missense probably benign 0.01
IGL03168:Rap1a APN 3 105750271 missense probably damaging 1.00
R2139:Rap1a UTSW 3 105739540 missense probably damaging 0.98
R5802:Rap1a UTSW 3 105745936 missense probably damaging 1.00
R5906:Rap1a UTSW 3 105737765 missense possibly damaging 0.90
R5941:Rap1a UTSW 3 105732069 missense possibly damaging 0.82
R6051:Rap1a UTSW 3 105750297 missense possibly damaging 0.91
R6251:Rap1a UTSW 3 105731995 nonsense probably null
R6856:Rap1a UTSW 3 105732068 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTAACGCTATACCTCTTTGG -3'
(R):5'- ATTAAAGAGTCTGGGACTGGTCC -3'

Sequencing Primer
(F):5'- CGCTATACCTCTTTGGCTACAAATAG -3'
(R):5'- GGACTGGTCCTATAAAGCTATTATTG -3'
Posted On2017-10-10