Incidental Mutation 'R6136:Steap4'
ID488342
Institutional Source Beutler Lab
Gene Symbol Steap4
Ensembl Gene ENSMUSG00000012428
Gene NameSTEAP family member 4
SynonymsTiarp, Tnfaip9
MMRRC Submission 044283-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R6136 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location7960457-7982213 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 7978562 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 380 (R380Q)
Ref Sequence ENSEMBL: ENSMUSP00000111081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115421]
Predicted Effect probably damaging
Transcript: ENSMUST00000115421
AA Change: R380Q

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111081
Gene: ENSMUSG00000012428
AA Change: R380Q

DomainStartEndE-ValueType
Pfam:F420_oxidored 21 107 2.3e-16 PFAM
transmembrane domain 203 225 N/A INTRINSIC
Pfam:Ferric_reduct 247 395 2.6e-14 PFAM
transmembrane domain 416 438 N/A INTRINSIC
Meta Mutation Damage Score 0.2708 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the STEAP (six transmembrane epithelial antigen of prostate) family, and resides in the golgi apparatus. It functions as a metalloreductase that has the ability to reduce both Fe(3+) to Fe(2+) and Cu(2+) to Cu(1+), using NAD(+) as acceptor. Studies in mice and human suggest that this gene maybe involved in adipocyte development and metabolism, and may contribute to the normal biology of the prostate cell, as well as prostate cancer progression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit adipose accumulation, oxidative stress, increased liver weight, lower metabolic rate, hypoactivity, insulin resistance, glucose intolerance, mild hyperglycemia and dyslipidemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,853 S729P probably damaging Het
3100002H09Rik C A 4: 124,610,388 G124C unknown Het
3425401B19Rik A T 14: 32,662,282 D575E possibly damaging Het
Abca15 A T 7: 120,340,049 H222L possibly damaging Het
Arhgef18 T C 8: 3,454,507 V1013A probably benign Het
Arsj T C 3: 126,364,775 M1T probably null Het
Atp10a A C 7: 58,828,340 Q1377P probably benign Het
Atrip T A 9: 109,071,736 E178D probably damaging Het
Chadl T C 15: 81,693,554 N625D probably benign Het
Chrng G A 1: 87,209,801 V320I probably benign Het
Cox11 T C 11: 90,644,395 L84P probably damaging Het
Dchs1 T G 7: 105,760,925 T1747P probably benign Het
Dnah12 A G 14: 26,875,270 K3529E probably damaging Het
Ecd T C 14: 20,320,791 N620S probably damaging Het
Fbn1 T A 2: 125,403,132 K278N possibly damaging Het
Fcho2 T C 13: 98,789,767 K103E probably damaging Het
Fzd7 T G 1: 59,483,260 F101V probably damaging Het
Galnt13 G T 2: 54,516,479 probably benign Het
Gif G A 19: 11,750,285 A158T probably damaging Het
Gm32647 C T 7: 94,475,732 Het
Gm5624 A T 14: 44,559,876 D152E probably benign Het
Heatr6 T A 11: 83,772,503 V664E possibly damaging Het
Hpgd A G 8: 56,294,952 D36G probably damaging Het
Ifnlr1 A G 4: 135,703,797 T199A possibly damaging Het
Kalrn T G 16: 34,357,111 D228A probably damaging Het
Miox T C 15: 89,335,321 M47T probably damaging Het
Nampt A T 12: 32,830,302 I65F probably benign Het
Ncf1 T C 5: 134,226,633 K135E probably damaging Het
Nop53 G A 7: 15,938,389 Q452* probably null Het
Olfr1037 A G 2: 86,084,901 L292S probably damaging Het
Pik3cg A G 12: 32,204,359 V543A probably benign Het
Ralgds T C 2: 28,550,565 probably null Het
Rap1a A G 3: 105,750,282 V7A probably damaging Het
Rasal1 T C 5: 120,675,478 V639A possibly damaging Het
Rassf8 A G 6: 145,815,656 N236S probably benign Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Sbno1 T C 5: 124,378,491 D1272G probably benign Het
Setx A G 2: 29,148,027 D1508G probably benign Het
Slc1a1 T A 19: 28,905,410 L358Q probably damaging Het
Slc7a12 C A 3: 14,499,126 L20I probably benign Het
Spats2l C T 1: 57,902,143 T187M probably damaging Het
Specc1l A G 10: 75,246,660 D647G probably benign Het
Syne2 A G 12: 75,905,325 S456G probably benign Het
Tfcp2 G T 15: 100,512,313 T391N probably damaging Het
Tns2 T A 15: 102,107,030 D122E probably damaging Het
Tshr A G 12: 91,538,234 M649V probably benign Het
Ubr3 A G 2: 69,993,763 T1440A probably benign Het
Urb2 A G 8: 124,030,092 D846G probably benign Het
Vmn1r202 T C 13: 22,501,462 T262A possibly damaging Het
Vmn2r61 G T 7: 42,267,031 W356L probably damaging Het
Wdr11 T A 7: 129,618,703 M605K possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Steap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Steap4 APN 5 7976979 missense probably damaging 1.00
IGL00827:Steap4 APN 5 7976712 missense probably damaging 1.00
IGL01481:Steap4 APN 5 7976858 missense probably damaging 0.98
IGL02378:Steap4 APN 5 7976741 missense probably benign 0.00
IGL03058:Steap4 APN 5 7975664 missense probably benign 0.00
PIT4362001:Steap4 UTSW 5 7980337 missense probably benign 0.03
R0329:Steap4 UTSW 5 7975829 missense possibly damaging 0.92
R0546:Steap4 UTSW 5 7975870 missense probably damaging 0.99
R0637:Steap4 UTSW 5 7978398 splice site probably benign
R0638:Steap4 UTSW 5 7977030 splice site probably benign
R0651:Steap4 UTSW 5 7980348 nonsense probably null
R0881:Steap4 UTSW 5 7980388 missense probably benign
R1167:Steap4 UTSW 5 7976520 missense probably benign 0.34
R1543:Steap4 UTSW 5 7975902 splice site probably benign
R1889:Steap4 UTSW 5 7975892 missense probably damaging 1.00
R3803:Steap4 UTSW 5 7976979 missense probably damaging 1.00
R3811:Steap4 UTSW 5 7977017 missense probably benign 0.18
R3885:Steap4 UTSW 5 7980494 missense probably damaging 1.00
R3887:Steap4 UTSW 5 7980494 missense probably damaging 1.00
R4051:Steap4 UTSW 5 7980404 missense probably damaging 1.00
R4208:Steap4 UTSW 5 7980404 missense probably damaging 1.00
R5016:Steap4 UTSW 5 7976699 nonsense probably null
R5302:Steap4 UTSW 5 7975547 nonsense probably null
R5951:Steap4 UTSW 5 7975769 missense probably benign 0.00
R6527:Steap4 UTSW 5 7978502 missense probably damaging 0.99
R6631:Steap4 UTSW 5 7976995 nonsense probably null
R6964:Steap4 UTSW 5 7975568 missense probably damaging 1.00
R7055:Steap4 UTSW 5 7976858 missense probably damaging 1.00
R7408:Steap4 UTSW 5 7978453 missense probably benign 0.07
R7692:Steap4 UTSW 5 7976976 missense probably benign 0.32
R8205:Steap4 UTSW 5 7976795 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TCCCCTTGGAAGAGTAAAGTAGAAG -3'
(R):5'- ATCGAGTCTGCCTGTCAGTG -3'

Sequencing Primer
(F):5'- GAAGGAACATCCATTGTAATTGTTTC -3'
(R):5'- GTCTGAGTTCATTTTTCTGAGCGAAC -3'
Posted On2017-10-10