Incidental Mutation 'R6136:Hpgd'
ID488355
Institutional Source Beutler Lab
Gene Symbol Hpgd
Ensembl Gene ENSMUSG00000031613
Gene Namehydroxyprostaglandin dehydrogenase 15 (NAD)
Synonyms15-PGDH
MMRRC Submission 044283-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6136 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location56294585-56321043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56294952 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 36 (D36G)
Ref Sequence ENSEMBL: ENSMUSP00000034026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034026]
Predicted Effect probably damaging
Transcript: ENSMUST00000034026
AA Change: D36G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034026
Gene: ENSMUSG00000031613
AA Change: D36G

DomainStartEndE-ValueType
Pfam:KR 6 175 6.6e-11 PFAM
Pfam:adh_short 6 199 1.7e-59 PFAM
Pfam:adh_short_C2 12 252 1.3e-18 PFAM
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain nonmetalloenzyme alcohol dehydrogenase protein family. The encoded enzyme is responsible for the metabolism of prostaglandins, which function in a variety of physiologic and cellular processes such as inflammation. Mutations in this gene result in primary autosomal recessive hypertrophic osteoarthropathy and cranioosteoarthropathy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous mutation of this gene results failure of the ductus arteriosus to close and perinatal lethality. Mutant animals die within 12-48 hours after birth due to congestive heart failure. Mice homozygous for a hypomorphic allele exhibit preterm labor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,853 S729P probably damaging Het
3100002H09Rik C A 4: 124,610,388 G124C unknown Het
3425401B19Rik A T 14: 32,662,282 D575E possibly damaging Het
Abca15 A T 7: 120,340,049 H222L possibly damaging Het
Arhgef18 T C 8: 3,454,507 V1013A probably benign Het
Arsj T C 3: 126,364,775 M1T probably null Het
Atp10a A C 7: 58,828,340 Q1377P probably benign Het
Atrip T A 9: 109,071,736 E178D probably damaging Het
Chadl T C 15: 81,693,554 N625D probably benign Het
Chrng G A 1: 87,209,801 V320I probably benign Het
Cox11 T C 11: 90,644,395 L84P probably damaging Het
Dchs1 T G 7: 105,760,925 T1747P probably benign Het
Dnah12 A G 14: 26,875,270 K3529E probably damaging Het
Ecd T C 14: 20,320,791 N620S probably damaging Het
Fbn1 T A 2: 125,403,132 K278N possibly damaging Het
Fcho2 T C 13: 98,789,767 K103E probably damaging Het
Fzd7 T G 1: 59,483,260 F101V probably damaging Het
Galnt13 G T 2: 54,516,479 probably benign Het
Gif G A 19: 11,750,285 A158T probably damaging Het
Gm32647 C T 7: 94,475,732 Het
Gm5624 A T 14: 44,559,876 D152E probably benign Het
Heatr6 T A 11: 83,772,503 V664E possibly damaging Het
Ifnlr1 A G 4: 135,703,797 T199A possibly damaging Het
Kalrn T G 16: 34,357,111 D228A probably damaging Het
Miox T C 15: 89,335,321 M47T probably damaging Het
Nampt A T 12: 32,830,302 I65F probably benign Het
Ncf1 T C 5: 134,226,633 K135E probably damaging Het
Nop53 G A 7: 15,938,389 Q452* probably null Het
Olfr1037 A G 2: 86,084,901 L292S probably damaging Het
Pik3cg A G 12: 32,204,359 V543A probably benign Het
Ralgds T C 2: 28,550,565 probably null Het
Rap1a A G 3: 105,750,282 V7A probably damaging Het
Rasal1 T C 5: 120,675,478 V639A possibly damaging Het
Rassf8 A G 6: 145,815,656 N236S probably benign Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Sbno1 T C 5: 124,378,491 D1272G probably benign Het
Setx A G 2: 29,148,027 D1508G probably benign Het
Slc1a1 T A 19: 28,905,410 L358Q probably damaging Het
Slc7a12 C A 3: 14,499,126 L20I probably benign Het
Spats2l C T 1: 57,902,143 T187M probably damaging Het
Specc1l A G 10: 75,246,660 D647G probably benign Het
Steap4 G A 5: 7,978,562 R380Q probably damaging Het
Syne2 A G 12: 75,905,325 S456G probably benign Het
Tfcp2 G T 15: 100,512,313 T391N probably damaging Het
Tns2 T A 15: 102,107,030 D122E probably damaging Het
Tshr A G 12: 91,538,234 M649V probably benign Het
Ubr3 A G 2: 69,993,763 T1440A probably benign Het
Urb2 A G 8: 124,030,092 D846G probably benign Het
Vmn1r202 T C 13: 22,501,462 T262A possibly damaging Het
Vmn2r61 G T 7: 42,267,031 W356L probably damaging Het
Wdr11 T A 7: 129,618,703 M605K possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Hpgd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01993:Hpgd APN 8 56319062 missense probably benign 0.04
R0703:Hpgd UTSW 8 56295039 missense probably damaging 1.00
R0705:Hpgd UTSW 8 56295039 missense probably damaging 1.00
R1138:Hpgd UTSW 8 56307677 missense probably benign 0.00
R2081:Hpgd UTSW 8 56307642 missense probably benign
R3177:Hpgd UTSW 8 56298413 missense probably damaging 1.00
R3277:Hpgd UTSW 8 56298413 missense probably damaging 1.00
R3782:Hpgd UTSW 8 56298418 missense probably damaging 1.00
R4774:Hpgd UTSW 8 56298419 missense probably damaging 1.00
R4874:Hpgd UTSW 8 56317803 missense possibly damaging 0.78
R5501:Hpgd UTSW 8 56298356 missense probably benign 0.04
R5828:Hpgd UTSW 8 56319071 missense probably benign 0.10
R5846:Hpgd UTSW 8 56307667 missense possibly damaging 0.90
R7252:Hpgd UTSW 8 56298426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAAGGACTTCTCCGTGTCCAC -3'
(R):5'- TAGAAGGTCACAGCTTCCCG -3'

Sequencing Primer
(F):5'- GTGTCCACCCACACGCC -3'
(R):5'- TCACAGCTTCCCGTGAGAGAG -3'
Posted On2017-10-10