Incidental Mutation 'R6136:Tshr'
ID488364
Institutional Source Beutler Lab
Gene Symbol Tshr
Ensembl Gene ENSMUSG00000020963
Gene Namethyroid stimulating hormone receptor
Synonymspet, hyt, hypothroid
MMRRC Submission 044283-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R6136 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location91384563-91549808 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91538234 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 649 (M649V)
Ref Sequence ENSEMBL: ENSMUSP00000021346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021346] [ENSMUST00000186437] [ENSMUST00000221216]
Predicted Effect probably benign
Transcript: ENSMUST00000021346
AA Change: M649V

PolyPhen 2 Score 0.343 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021346
Gene: ENSMUSG00000020963
AA Change: M649V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:LRR_5 53 153 9.5e-7 PFAM
Pfam:LRR_5 148 244 5.1e-5 PFAM
Pfam:7tm_1 431 678 2.6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186437
AA Change: M57V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139632
Gene: ENSMUSG00000020963
AA Change: M57V

DomainStartEndE-ValueType
Pfam:7tm_1 1 86 6.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221216
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein and a major controller of thyroid cell metabolism. The encoded protein is a receptor for thyrothropin and thyrostimulin, and its activity is mediated by adenylate cyclase. Defects in this gene are a cause of several types of hyperthyroidism. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene exhibit profound hypothyroidism, developmental and growth retardation, impaired hearing with cochlear defects, and infertility. One mutation results in high postweaning mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,853 S729P probably damaging Het
3100002H09Rik C A 4: 124,610,388 G124C unknown Het
3425401B19Rik A T 14: 32,662,282 D575E possibly damaging Het
Abca15 A T 7: 120,340,049 H222L possibly damaging Het
Arhgef18 T C 8: 3,454,507 V1013A probably benign Het
Arsj T C 3: 126,364,775 M1T probably null Het
Atp10a A C 7: 58,828,340 Q1377P probably benign Het
Atrip T A 9: 109,071,736 E178D probably damaging Het
Chadl T C 15: 81,693,554 N625D probably benign Het
Chrng G A 1: 87,209,801 V320I probably benign Het
Cox11 T C 11: 90,644,395 L84P probably damaging Het
Dchs1 T G 7: 105,760,925 T1747P probably benign Het
Dnah12 A G 14: 26,875,270 K3529E probably damaging Het
Ecd T C 14: 20,320,791 N620S probably damaging Het
Fbn1 T A 2: 125,403,132 K278N possibly damaging Het
Fcho2 T C 13: 98,789,767 K103E probably damaging Het
Fzd7 T G 1: 59,483,260 F101V probably damaging Het
Galnt13 G T 2: 54,516,479 probably benign Het
Gif G A 19: 11,750,285 A158T probably damaging Het
Gm32647 C T 7: 94,475,732 Het
Gm5624 A T 14: 44,559,876 D152E probably benign Het
Heatr6 T A 11: 83,772,503 V664E possibly damaging Het
Hpgd A G 8: 56,294,952 D36G probably damaging Het
Ifnlr1 A G 4: 135,703,797 T199A possibly damaging Het
Kalrn T G 16: 34,357,111 D228A probably damaging Het
Miox T C 15: 89,335,321 M47T probably damaging Het
Nampt A T 12: 32,830,302 I65F probably benign Het
Ncf1 T C 5: 134,226,633 K135E probably damaging Het
Nop53 G A 7: 15,938,389 Q452* probably null Het
Olfr1037 A G 2: 86,084,901 L292S probably damaging Het
Pik3cg A G 12: 32,204,359 V543A probably benign Het
Ralgds T C 2: 28,550,565 probably null Het
Rap1a A G 3: 105,750,282 V7A probably damaging Het
Rasal1 T C 5: 120,675,478 V639A possibly damaging Het
Rassf8 A G 6: 145,815,656 N236S probably benign Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Sbno1 T C 5: 124,378,491 D1272G probably benign Het
Setx A G 2: 29,148,027 D1508G probably benign Het
Slc1a1 T A 19: 28,905,410 L358Q probably damaging Het
Slc7a12 C A 3: 14,499,126 L20I probably benign Het
Spats2l C T 1: 57,902,143 T187M probably damaging Het
Specc1l A G 10: 75,246,660 D647G probably benign Het
Steap4 G A 5: 7,978,562 R380Q probably damaging Het
Syne2 A G 12: 75,905,325 S456G probably benign Het
Tfcp2 G T 15: 100,512,313 T391N probably damaging Het
Tns2 T A 15: 102,107,030 D122E probably damaging Het
Ubr3 A G 2: 69,993,763 T1440A probably benign Het
Urb2 A G 8: 124,030,092 D846G probably benign Het
Vmn1r202 T C 13: 22,501,462 T262A possibly damaging Het
Vmn2r61 G T 7: 42,267,031 W356L probably damaging Het
Wdr11 T A 7: 129,618,703 M605K possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Tshr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00647:Tshr APN 12 91537500 missense probably damaging 1.00
IGL01503:Tshr APN 12 91511934 missense probably damaging 1.00
IGL01730:Tshr APN 12 91519303 missense possibly damaging 0.93
IGL02109:Tshr APN 12 91537992 missense probably damaging 1.00
IGL02199:Tshr APN 12 91538283 missense probably damaging 1.00
IGL02439:Tshr APN 12 91537547 missense probably damaging 0.97
IGL02696:Tshr APN 12 91493329 missense possibly damaging 0.72
IGL03170:Tshr APN 12 91537869 missense probably damaging 1.00
IGL03208:Tshr APN 12 91533942 missense probably damaging 1.00
freckle UTSW 12 91538226 nonsense probably null
R0017:Tshr UTSW 12 91537886 missense possibly damaging 0.95
R0017:Tshr UTSW 12 91537886 missense possibly damaging 0.95
R0067:Tshr UTSW 12 91505283 missense probably damaging 1.00
R0419:Tshr UTSW 12 91537869 missense probably damaging 1.00
R0658:Tshr UTSW 12 91538226 nonsense probably null
R0724:Tshr UTSW 12 91538286 missense probably damaging 1.00
R1170:Tshr UTSW 12 91538097 missense probably damaging 1.00
R1188:Tshr UTSW 12 91502168 missense probably benign 0.00
R1548:Tshr UTSW 12 91534031 missense probably damaging 1.00
R1677:Tshr UTSW 12 91537341 missense possibly damaging 0.81
R1808:Tshr UTSW 12 91537316 missense probably benign 0.00
R1934:Tshr UTSW 12 91537181 missense probably damaging 0.99
R3980:Tshr UTSW 12 91537743 missense probably damaging 1.00
R4008:Tshr UTSW 12 91537494 missense probably benign 0.21
R4828:Tshr UTSW 12 91537790 missense probably damaging 1.00
R4903:Tshr UTSW 12 91401188 missense probably benign 0.09
R4958:Tshr UTSW 12 91538187 missense probably damaging 1.00
R5528:Tshr UTSW 12 91537193 missense probably damaging 1.00
R5949:Tshr UTSW 12 91537218 missense probably damaging 1.00
R6147:Tshr UTSW 12 91538235 missense possibly damaging 0.84
R6454:Tshr UTSW 12 91538549 missense probably benign 0.33
R6572:Tshr UTSW 12 91538360 missense probably benign 0.29
R6884:Tshr UTSW 12 91538102 missense probably damaging 1.00
R6986:Tshr UTSW 12 91533957 missense probably damaging 0.97
R7403:Tshr UTSW 12 91497774 missense probably damaging 1.00
R7691:Tshr UTSW 12 91497741 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGTTCTGCTGCTCAATGTTG -3'
(R):5'- TACCAGTGCTATTGTTGGGAC -3'

Sequencing Primer
(F):5'- GCTGCTCAATGTTGTTGCC -3'
(R):5'- AGACTCTCTGACCCTGATAGG -3'
Posted On2017-10-10